Incidental Mutation 'R5918:Senp6'
ID461476
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5918 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 80114116 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176640]
Predicted Effect probably null
Transcript: ENSMUST00000037484
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164859
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165458
Predicted Effect probably null
Transcript: ENSMUST00000165607
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175910
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect probably benign
Transcript: ENSMUST00000176360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176607
SMART Domains Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 4.9e-23 PFAM
Pfam:Peptidase_C48 799 911 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176640
Predicted Effect probably null
Transcript: ENSMUST00000176648
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 unclassified probably null
R0308:Senp6 UTSW 9 80132983 critical splice donor site probably null
R0531:Senp6 UTSW 9 80123884 missense probably damaging 0.99
R0743:Senp6 UTSW 9 80093589 missense probably damaging 1.00
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5800:Senp6 UTSW 9 80126433 missense probably damaging 1.00
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5899:Senp6 UTSW 9 80142070 splice site probably benign
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCATCAGAACTCTGGAGGAC -3'
(R):5'- AATCCCCAAATGATTCGTATGTGC -3'

Sequencing Primer
(F):5'- TGGAGGACAGAAATCACAAAACAC -3'
(R):5'- CGTATGTGCTATAAAAAGACACCTC -3'
Posted On2017-02-28