Incidental Mutation 'R5918:Zscan29'
ID461448
Institutional Source Beutler Lab
Gene Symbol Zscan29
Ensembl Gene ENSMUSG00000050619
Gene Namezinc finger SCAN domains 29
SynonymsZfp690
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5918 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121158273-121171125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121164037 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 489 (T489N)
Ref Sequence ENSEMBL: ENSMUSP00000125987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079024] [ENSMUST00000110661] [ENSMUST00000146243] [ENSMUST00000163766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079024
AA Change: T454N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619
AA Change: T454N

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 3e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 4.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110661
AA Change: T454N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619
AA Change: T454N

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.4e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 7.4e-22 PFAM
low complexity region 518 532 N/A INTRINSIC
ZnF_C2H2 665 687 2.99e-4 SMART
ZnF_C2H2 693 715 2.75e-3 SMART
ZnF_C2H2 721 743 8.02e-5 SMART
ZnF_C2H2 749 771 1.13e-4 SMART
ZnF_C2H2 777 799 1.18e-2 SMART
ZnF_C2H2 805 827 1.33e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156370
Predicted Effect probably damaging
Transcript: ENSMUST00000163766
AA Change: T489N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619
AA Change: T489N

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Other mutations in Zscan29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zscan29 APN 2 121170057 missense probably damaging 1.00
IGL01938:Zscan29 APN 2 121166209 missense probably benign 0.16
IGL02220:Zscan29 APN 2 121166689 missense probably damaging 0.99
IGL02370:Zscan29 APN 2 121163833 missense probably benign 0.00
IGL02585:Zscan29 APN 2 121163876 nonsense probably null
R0284:Zscan29 UTSW 2 121166733 unclassified probably benign
R0842:Zscan29 UTSW 2 121161479 missense possibly damaging 0.84
R1245:Zscan29 UTSW 2 121166503 missense probably damaging 1.00
R1586:Zscan29 UTSW 2 121161160 missense probably damaging 1.00
R1654:Zscan29 UTSW 2 121164779 missense probably benign 0.06
R1958:Zscan29 UTSW 2 121169808 critical splice donor site probably null
R2073:Zscan29 UTSW 2 121160855 nonsense probably null
R2085:Zscan29 UTSW 2 121169946 nonsense probably null
R2145:Zscan29 UTSW 2 121170106 missense probably damaging 1.00
R2201:Zscan29 UTSW 2 121169402 missense probably damaging 1.00
R2875:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R2876:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R3861:Zscan29 UTSW 2 121160731 missense probably benign 0.01
R4244:Zscan29 UTSW 2 121164794 unclassified probably null
R4245:Zscan29 UTSW 2 121164794 unclassified probably null
R4447:Zscan29 UTSW 2 121169886 unclassified probably null
R4662:Zscan29 UTSW 2 121166615 missense probably benign 0.26
R4757:Zscan29 UTSW 2 121160911 missense possibly damaging 0.92
R4777:Zscan29 UTSW 2 121169324 missense probably damaging 0.96
R4905:Zscan29 UTSW 2 121161383 missense possibly damaging 0.53
R4970:Zscan29 UTSW 2 121169195 splice site probably null
R5860:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5861:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5862:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5916:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5917:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R6335:Zscan29 UTSW 2 121161436 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GGTTCTCTGGAGGCAACAAG -3'
(R):5'- TTTCCTAGAAGCCGGCAGTAAAAC -3'

Sequencing Primer
(F):5'- CTCTGGAGGCAACAAGAAACTGTTTC -3'
(R):5'- AGGTGATGCTGAAATCTCTCTTC -3'
Posted On2017-02-28