Incidental Mutation 'R0567:Rad50'
ID46224
Institutional Source Beutler Lab
Gene Symbol Rad50
Ensembl Gene ENSMUSG00000020380
Gene NameRAD50 double strand break repair protein
SynonymsRad50l, Mrell
MMRRC Submission 038758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0567 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53649519-53707319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53654956 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1180 (R1180Q)
Ref Sequence ENSEMBL: ENSMUSP00000020649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020649]
Predicted Effect probably damaging
Transcript: ENSMUST00000020649
AA Change: R1180Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380
AA Change: R1180Q

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 1.8e-31 PFAM
coiled coil region 397 534 N/A INTRINSIC
Pfam:Rad50_zn_hook 659 712 9.9e-16 PFAM
low complexity region 825 836 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
coiled coil region 1019 1075 N/A INTRINSIC
Pfam:SbcCD_C 1174 1251 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,228,016 E303G probably damaging Het
Akr1b3 A T 6: 34,304,345 probably null Het
Alox8 A T 11: 69,191,522 probably null Het
Apcdd1 G A 18: 62,934,036 E74K possibly damaging Het
Atr T C 9: 95,865,829 V388A probably benign Het
AW554918 G A 18: 25,400,035 E452K possibly damaging Het
C1galt1 A G 6: 7,866,874 D240G probably damaging Het
Ccdc130 A G 8: 84,260,665 L93P probably damaging Het
Ceacam10 T A 7: 24,778,409 D116E probably damaging Het
Col15a1 G T 4: 47,293,231 V912L possibly damaging Het
Cyp3a11 G A 5: 145,869,149 T136I probably damaging Het
Denr C T 5: 123,908,158 T17M probably benign Het
Doc2b A G 11: 75,780,124 F227S probably damaging Het
Dsp A T 13: 38,192,438 T1400S probably benign Het
Egfr A T 11: 16,872,873 D412V probably benign Het
Fryl C T 5: 73,065,391 G1949D possibly damaging Het
Gstp3 A T 19: 4,057,636 L176Q possibly damaging Het
Heatr5a T A 12: 51,910,089 N1075I probably damaging Het
Hist1h2ah T C 13: 22,035,564 probably benign Het
Ighv1-69 C T 12: 115,623,549 probably benign Het
Lama3 A G 18: 12,549,252 I1092V probably benign Het
Lipg A T 18: 74,957,369 H36Q probably benign Het
Myh7b T C 2: 155,626,398 W836R probably damaging Het
Oit3 A T 10: 59,435,978 C186S probably damaging Het
Olfr734 A T 14: 50,320,658 M59K probably damaging Het
P2ry2 T C 7: 100,998,541 T186A probably damaging Het
Pyroxd2 T C 19: 42,735,925 T300A probably benign Het
Rab26 C A 17: 24,529,582 V283F probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Shroom3 A G 5: 92,964,453 D1891G possibly damaging Het
Syne2 G A 12: 75,890,230 E201K probably damaging Het
Taf6 A T 5: 138,183,726 probably null Het
Tbc1d32 A T 10: 56,173,963 M493K possibly damaging Het
Uaca A G 9: 60,871,381 T1017A probably benign Het
Usp17le C T 7: 104,768,898 V346I possibly damaging Het
Vmn1r71 T C 7: 10,748,629 D44G probably damaging Het
Vmn2r80 A G 10: 79,194,831 I830M possibly damaging Het
Zfp994 T C 17: 22,200,468 Y500C possibly damaging Het
Zscan20 A G 4: 128,589,450 probably null Het
Other mutations in Rad50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Rad50 APN 11 53686311 intron probably benign
IGL00709:Rad50 APN 11 53669642 missense possibly damaging 0.49
IGL01080:Rad50 APN 11 53706068 missense probably damaging 1.00
IGL01357:Rad50 APN 11 53707021 missense probably damaging 1.00
IGL01979:Rad50 APN 11 53686178 nonsense probably null
IGL02481:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02483:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02673:Rad50 APN 11 53688240 missense probably benign 0.19
IGL02754:Rad50 APN 11 53702056 missense probably damaging 1.00
IGL03372:Rad50 APN 11 53695294 missense probably benign 0.20
PIT4131001:Rad50 UTSW 11 53694899 critical splice donor site probably null
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0270:Rad50 UTSW 11 53668025 missense probably damaging 1.00
R0373:Rad50 UTSW 11 53650519 missense probably damaging 1.00
R1132:Rad50 UTSW 11 53694961 missense possibly damaging 0.58
R1249:Rad50 UTSW 11 53692137 missense probably damaging 0.99
R1368:Rad50 UTSW 11 53683245 nonsense probably null
R1501:Rad50 UTSW 11 53688151 missense possibly damaging 0.68
R1506:Rad50 UTSW 11 53679485 missense probably damaging 0.98
R1633:Rad50 UTSW 11 53692859 missense probably benign 0.00
R1663:Rad50 UTSW 11 53668223 missense probably benign 0.01
R1847:Rad50 UTSW 11 53702107 missense possibly damaging 0.68
R1933:Rad50 UTSW 11 53680061 missense probably benign 0.16
R2176:Rad50 UTSW 11 53698209 missense probably benign 0.00
R2519:Rad50 UTSW 11 53707185 start gained probably benign
R3027:Rad50 UTSW 11 53695381 missense probably benign 0.00
R3894:Rad50 UTSW 11 53678870 missense probably benign 0.01
R4181:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4302:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4836:Rad50 UTSW 11 53650653 missense probably damaging 1.00
R4934:Rad50 UTSW 11 53684275 missense probably benign 0.05
R5047:Rad50 UTSW 11 53674696 critical splice donor site probably null
R5201:Rad50 UTSW 11 53698820 critical splice donor site probably null
R5325:Rad50 UTSW 11 53692863 missense probably benign 0.16
R5368:Rad50 UTSW 11 53684246 missense probably benign 0.02
R5403:Rad50 UTSW 11 53695281 critical splice donor site probably null
R5421:Rad50 UTSW 11 53674946 missense probably benign 0.02
R6282:Rad50 UTSW 11 53669770 splice site probably null
R6468:Rad50 UTSW 11 53692144 missense possibly damaging 0.81
R6469:Rad50 UTSW 11 53684235 missense probably benign 0.08
R6528:Rad50 UTSW 11 53652282 missense probably damaging 1.00
R6704:Rad50 UTSW 11 53698918 missense probably damaging 1.00
R6886:Rad50 UTSW 11 53686184 missense probably benign 0.01
R7055:Rad50 UTSW 11 53688102 missense probably benign 0.02
R7268:Rad50 UTSW 11 53684275 missense probably benign 0.01
R7288:Rad50 UTSW 11 53654949 nonsense probably null
R7380:Rad50 UTSW 11 53695396 missense probably benign 0.00
R7467:Rad50 UTSW 11 53654908 missense probably damaging 1.00
R7533:Rad50 UTSW 11 53698919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCCATGTCTGTCTCACAAGG -3'
(R):5'- GCAGACCACATGATCTGAGTCTTCC -3'

Sequencing Primer
(F):5'- CCAGGAAGCTGTAGGAGC -3'
(R):5'- TTGCAAGGCAGCCAGTG -3'
Posted On2013-06-11