Incidental Mutation 'R5951:Glg1'
ID470893
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Namegolgi apparatus protein 1
SynonymsSelel, CFR, MG-160, CFR-1, ESL-1, MG160
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.718) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111154421-111259216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111165691 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 841 (I841V)
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003404
AA Change: I830V

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: I830V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168741
AA Change: I234V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316
AA Change: I234V

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169020
AA Change: I841V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: I841V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1899:Glg1 UTSW 8 111165674 missense probably benign 0.23
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2275:Glg1 UTSW 8 111168721 nonsense probably null
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6476:Glg1 UTSW 8 111200174 missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCACCATGTTGGCTGTG -3'
(R):5'- CCTGGAATTAGAAACAAAAGGTCC -3'

Sequencing Primer
(F):5'- GGAAAGGATCACACTGCTATTGTCAC -3'
(R):5'- GTCCTGGGTTAGAAAAACAGTG -3'
Posted On2017-03-31