Incidental Mutation 'R5946:Pgbd5'
ID472179
Institutional Source Beutler Lab
Gene Symbol Pgbd5
Ensembl Gene ENSMUSG00000050751
Gene NamepiggyBac transposable element derived 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5946 (G1)
Quality Score197
Status Not validated
Chromosome8
Chromosomal Location124369049-124439658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124374317 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 400 (M400K)
Ref Sequence ENSEMBL: ENSMUSP00000120984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052580] [ENSMUST00000136892] [ENSMUST00000140012] [ENSMUST00000172566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052580
AA Change: M286K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054788
Gene: ENSMUSG00000050751
AA Change: M286K

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128312
Predicted Effect possibly damaging
Transcript: ENSMUST00000136892
AA Change: M286K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123265
Gene: ENSMUSG00000050751
AA Change: M286K

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140012
AA Change: M400K

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120984
Gene: ENSMUSG00000050751
AA Change: M400K

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 120 486 5.6e-90 PFAM
low complexity region 506 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140126
Predicted Effect possibly damaging
Transcript: ENSMUST00000172566
AA Change: M309K

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133560
Gene: ENSMUSG00000050751
AA Change: M309K

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 29 395 2e-86 PFAM
low complexity region 415 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,625,952 F1137S probably damaging Het
Actr6 G T 10: 89,728,192 Q73K probably benign Het
Adamtsl3 G A 7: 82,576,057 G358D probably damaging Het
Aggf1 A G 13: 95,371,576 V94A probably damaging Het
Arpc3 A G 5: 122,403,396 Y57C probably damaging Het
Asb2 A G 12: 103,321,555 Y630H probably benign Het
Atp1a1 A T 3: 101,589,774 N405K probably benign Het
C6 G T 15: 4,808,514 D869Y possibly damaging Het
Cds2 A G 2: 132,297,248 Y137C probably damaging Het
Ceacam12 A T 7: 18,069,206 E179V probably damaging Het
Chgb T A 2: 132,792,596 Y153N probably benign Het
Cit T A 5: 115,997,534 L1831Q probably damaging Het
Cpne8 C A 15: 90,488,988 *578L probably null Het
Cspg5 A G 9: 110,251,083 T440A probably damaging Het
Dnah7a A C 1: 53,559,308 V1393G probably damaging Het
Dnajb8 A G 6: 88,222,593 D37G probably benign Het
Dst A G 1: 34,174,192 I1063M probably benign Het
Efs T G 14: 54,919,494 probably null Het
Gpatch1 A G 7: 35,291,832 S596P probably damaging Het
Hbs1l C A 10: 21,341,756 H190Q probably benign Het
Ighm A G 12: 113,422,709 V7A unknown Het
Ivd A T 2: 118,876,889 I295F possibly damaging Het
Kcnq5 A C 1: 21,505,707 S258A probably damaging Het
Mad1l1 G T 5: 140,261,579 P331Q probably damaging Het
Mcf2l G T 8: 13,013,922 G1045C probably damaging Het
Mcoln1 T A 8: 3,508,701 I233N probably damaging Het
Mmp13 T C 9: 7,276,580 L225P probably damaging Het
Muc5ac G A 7: 141,817,907 C2615Y possibly damaging Het
Myh7b T C 2: 155,621,395 F516L probably damaging Het
Obsl1 A T 1: 75,491,207 S1347R probably damaging Het
Ogn A G 13: 49,618,285 N207S probably benign Het
Olfr132 C A 17: 38,130,707 A162S probably benign Het
Olfr874 T A 9: 37,747,034 L300Q probably damaging Het
Pcdha2 G T 18: 36,941,106 V597L probably damaging Het
Pcnt T A 10: 76,382,063 Y2126F possibly damaging Het
Pklr A T 3: 89,136,196 E5V probably benign Het
Pkp4 T A 2: 59,305,067 D94E probably benign Het
Ppan C T 9: 20,889,673 Q111* probably null Het
Prkcb A G 7: 122,544,703 N330S probably benign Het
Prl4a1 T A 13: 28,018,516 W25R probably damaging Het
Rars2 T A 4: 34,656,855 H501Q possibly damaging Het
Ryr2 T C 13: 11,726,953 D2114G probably damaging Het
Serinc2 G T 4: 130,255,521 T351K possibly damaging Het
Slc22a12 A G 19: 6,537,851 F358L probably damaging Het
Sorcs2 A C 5: 36,029,083 V905G probably damaging Het
Tekt3 G C 11: 63,094,747 A460P probably damaging Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Tmc5 A T 7: 118,670,725 E899D probably damaging Het
Tmem268 C T 4: 63,568,509 P90S probably damaging Het
Trim38 A G 13: 23,782,734 M55V probably benign Het
Trip10 T G 17: 57,250,963 V50G probably damaging Het
Usp25 T A 16: 77,115,054 C990* probably null Het
Uts2 A G 4: 150,999,049 D39G probably benign Het
Vezf1 T A 11: 88,073,734 C49* probably null Het
Wee2 T A 6: 40,463,212 N431K probably null Het
Yeats2 C A 16: 20,207,763 Y796* probably null Het
Zfp592 G A 7: 81,037,897 G890D possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Pgbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pgbd5 APN 8 124384202 missense probably benign 0.00
IGL01669:Pgbd5 APN 8 124374399 missense possibly damaging 0.86
IGL01759:Pgbd5 APN 8 124384379 missense probably damaging 1.00
IGL01762:Pgbd5 APN 8 124370610 missense probably damaging 1.00
IGL02398:Pgbd5 APN 8 124384518 missense probably damaging 1.00
R0348:Pgbd5 UTSW 8 124434032 missense probably damaging 0.98
R0702:Pgbd5 UTSW 8 124374255 missense probably benign 0.21
R0981:Pgbd5 UTSW 8 124384293 nonsense probably null
R1259:Pgbd5 UTSW 8 124370585 missense probably damaging 0.98
R1598:Pgbd5 UTSW 8 124374287 missense probably benign 0.26
R1609:Pgbd5 UTSW 8 124434011 missense probably benign 0.00
R1742:Pgbd5 UTSW 8 124380307 missense probably damaging 1.00
R1938:Pgbd5 UTSW 8 124374249 nonsense probably null
R1985:Pgbd5 UTSW 8 124370592 missense probably benign 0.00
R2169:Pgbd5 UTSW 8 124384624 critical splice acceptor site probably null
R4573:Pgbd5 UTSW 8 124376227 nonsense probably null
R4917:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4918:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4946:Pgbd5 UTSW 8 124370585 missense possibly damaging 0.93
R5409:Pgbd5 UTSW 8 124371880 missense probably damaging 1.00
R5885:Pgbd5 UTSW 8 124384466 missense probably damaging 1.00
R6907:Pgbd5 UTSW 8 124380282 missense probably damaging 0.97
R6986:Pgbd5 UTSW 8 124384473 missense possibly damaging 0.56
R7144:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R7342:Pgbd5 UTSW 8 124433970 missense probably benign 0.36
X0067:Pgbd5 UTSW 8 124371912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGATGAGACCAAGCCACC -3'
(R):5'- ATGGCCTCAGTGACCTTCAG -3'

Sequencing Primer
(F):5'- GCTAAGAGCTTCGTGCAGC -3'
(R):5'- AAAGGCCTCAGCAGCTG -3'
Posted On2017-03-31