Incidental Mutation 'R4899:Zfr'
ID472513
Institutional Source Beutler Lab
Gene Symbol Zfr
Ensembl Gene ENSMUSG00000022201
Gene Namezinc finger RNA binding protein
Synonyms
MMRRC Submission 042503-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4899 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12117831-12185683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12166145 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 834 (V834I)
Ref Sequence ENSEMBL: ENSMUSP00000118911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122941]
Predicted Effect probably benign
Transcript: ENSMUST00000122941
AA Change: V834I

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: V834I

DomainStartEndE-ValueType
low complexity region 69 116 N/A INTRINSIC
low complexity region 159 182 N/A INTRINSIC
low complexity region 196 224 N/A INTRINSIC
low complexity region 229 302 N/A INTRINSIC
ZnF_U1 328 362 7.79e-6 SMART
ZnF_C2H2 331 355 4.94e0 SMART
ZnF_U1 379 413 1.84e-7 SMART
ZnF_C2H2 382 406 4.65e-1 SMART
low complexity region 429 448 N/A INTRINSIC
low complexity region 468 483 N/A INTRINSIC
ZnF_U1 579 613 2.01e-8 SMART
ZnF_C2H2 582 606 1.31e0 SMART
low complexity region 630 664 N/A INTRINSIC
low complexity region 685 719 N/A INTRINSIC
low complexity region 766 782 N/A INTRINSIC
DZF 784 1038 5.42e-170 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147492
Predicted Effect probably benign
Transcript: ENSMUST00000155054
SMART Domains Protein: ENSMUSP00000114992
Gene: ENSMUSG00000022201

DomainStartEndE-ValueType
low complexity region 19 53 N/A INTRINSIC
PDB:4ATB|D 56 94 6e-11 PDB
low complexity region 100 114 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156752
AA Change: V106I
SMART Domains Protein: ENSMUSP00000119251
Gene: ENSMUSG00000022201
AA Change: V106I

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
DZF 57 299 1.79e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157034
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Other mutations in Zfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Zfr APN 15 12159646 missense probably benign 0.26
IGL01759:Zfr APN 15 12159655 missense probably damaging 0.99
IGL01935:Zfr APN 15 12180712 missense probably benign 0.42
IGL02056:Zfr APN 15 12154447 missense probably damaging 1.00
IGL03009:Zfr APN 15 12162235 missense probably damaging 1.00
IGL03147:Zfr UTSW 15 12140552 nonsense probably null
R0377:Zfr UTSW 15 12160591 missense probably benign 0.02
R0678:Zfr UTSW 15 12184085 missense probably damaging 1.00
R0783:Zfr UTSW 15 12162182 missense probably damaging 1.00
R0787:Zfr UTSW 15 12140548 missense unknown
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1464:Zfr UTSW 15 12146372 missense probably damaging 1.00
R1538:Zfr UTSW 15 12150243 missense possibly damaging 0.61
R1558:Zfr UTSW 15 12140644 missense unknown
R1619:Zfr UTSW 15 12150387 missense possibly damaging 0.52
R1924:Zfr UTSW 15 12160629 missense possibly damaging 0.74
R2163:Zfr UTSW 15 12162223 missense probably damaging 1.00
R2958:Zfr UTSW 15 12162233 missense probably benign 0.08
R2960:Zfr UTSW 15 12162233 missense probably benign 0.08
R2961:Zfr UTSW 15 12162233 missense probably benign 0.08
R2962:Zfr UTSW 15 12162233 missense probably benign 0.08
R2963:Zfr UTSW 15 12162233 missense probably benign 0.08
R3012:Zfr UTSW 15 12166163 missense probably damaging 1.00
R3054:Zfr UTSW 15 12154507 missense probably damaging 1.00
R3429:Zfr UTSW 15 12152920 missense probably benign 0.00
R3611:Zfr UTSW 15 12159762 critical splice donor site probably null
R3825:Zfr UTSW 15 12166191 missense probably damaging 1.00
R3882:Zfr UTSW 15 12162233 missense probably benign 0.08
R4080:Zfr UTSW 15 12162233 missense probably benign 0.08
R4241:Zfr UTSW 15 12149659 missense probably damaging 1.00
R4366:Zfr UTSW 15 12156330 missense probably damaging 0.99
R4375:Zfr UTSW 15 12118340 critical splice donor site probably null
R4893:Zfr UTSW 15 12136542 missense unknown
R4915:Zfr UTSW 15 12162112 critical splice acceptor site probably null
R5870:Zfr UTSW 15 12160615 missense probably damaging 1.00
R6162:Zfr UTSW 15 12146245 missense unknown
R6163:Zfr UTSW 15 12146245 missense unknown
R6165:Zfr UTSW 15 12146245 missense unknown
R6187:Zfr UTSW 15 12146231 small deletion probably benign
R6251:Zfr UTSW 15 12160591 missense probably benign 0.02
R6903:Zfr UTSW 15 12136455 missense unknown
R6959:Zfr UTSW 15 12150323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTAATCTGGGTACTCTGGCATG -3'
(R):5'- AGCATGTTGCCTTCTAGGG -3'

Sequencing Primer
(F):5'- ACTCTGGCATGTGTTTTTAGAGG -3'
(R):5'- CTGAATGCCATCATAAAGGGTAG -3'
Posted On2017-04-14