Incidental Mutation 'R5371:Fdft1'
ID478309
Institutional Source Beutler Lab
Gene Symbol Fdft1
Ensembl Gene ENSMUSG00000021273
Gene Namefarnesyl diphosphate farnesyl transferase 1
Synonymssqualene synthase, SQS, Ss
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5371 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location63145150-63179578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63151301 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 294 (V294A)
Ref Sequence ENSEMBL: ENSMUSP00000153671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054963] [ENSMUST00000224625]
Predicted Effect probably damaging
Transcript: ENSMUST00000054963
AA Change: V294A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055313
Gene: ENSMUSG00000021273
AA Change: V294A

DomainStartEndE-ValueType
Pfam:SQS_PSY 47 320 2.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224625
AA Change: V294A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die around E9.5-10.5. Conditional homozygous null in which the gene is deleted specifically in oligodendrocyte and Schwann cell display dysmyelination of spinal cord and brain white matter, and showed ataxia and tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,562,493 noncoding transcript Het
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Ccdc9 A T 7: 16,280,730 D195E probably damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Lpp T C 16: 24,889,804 C295R probably damaging Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr156 A T 4: 43,821,058 M101K probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Speg G T 1: 75,431,393 R3244L possibly damaging Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tcerg1 T A 18: 42,519,535 M76K unknown Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in Fdft1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Fdft1 APN 14 63163389 nonsense probably null
PIT4515001:Fdft1 UTSW 14 63164583 missense probably benign 0.30
R0012:Fdft1 UTSW 14 63177698 missense probably benign 0.03
R0442:Fdft1 UTSW 14 63163349 missense probably benign 0.29
R0735:Fdft1 UTSW 14 63163420 missense probably damaging 1.00
R1674:Fdft1 UTSW 14 63164585 missense probably benign 0.20
R1689:Fdft1 UTSW 14 63156689 missense probably benign 0.00
R3116:Fdft1 UTSW 14 63177698 missense probably benign 0.03
R3418:Fdft1 UTSW 14 63156621 missense probably damaging 1.00
R5033:Fdft1 UTSW 14 63163404 missense probably damaging 1.00
R5274:Fdft1 UTSW 14 63152343 missense probably damaging 1.00
R5747:Fdft1 UTSW 14 63146839 missense probably damaging 1.00
R6343:Fdft1 UTSW 14 63151272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTGGTTAAACAGCGAC -3'
(R):5'- GGCTAAATGACAGAATAACCCTGTTG -3'

Sequencing Primer
(F):5'- GGTTAAACAGCGACATGATTTAATGC -3'
(R):5'- CCCTGTTGGTGAGTGTGG -3'
Posted On2017-06-23