Incidental Mutation 'R5996:Slfn9'
ID481143
Institutional Source Beutler Lab
Gene Symbol Slfn9
Ensembl Gene ENSMUSG00000069793
Gene Nameschlafen 9
Synonyms
MMRRC Submission 044175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5996 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82978390-82991830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82987484 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000115273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038211] [ENSMUST00000092840] [ENSMUST00000138797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038211
AA Change: I273T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044435
Gene: ENSMUSG00000069793
AA Change: I273T

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AlbA_2 205 343 2.3e-17 PFAM
Pfam:DUF2075 592 766 9.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092840
AA Change: I273T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090515
Gene: ENSMUSG00000069793
AA Change: I273T

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 1.6e-18 PFAM
Pfam:DUF2075 592 766 1.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138797
AA Change: I273T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115273
Gene: ENSMUSG00000069793
AA Change: I273T

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 3.8e-19 PFAM
Pfam:DUF2075 592 642 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183379
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,518,928 M1T probably null Het
4932438A13Rik T C 3: 36,931,116 F865S probably benign Het
A2m T A 6: 121,659,394 W741R probably damaging Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acan A G 7: 79,111,320 T1927A probably damaging Het
Agbl4 A G 4: 110,955,672 probably null Het
Ccr8 T A 9: 120,094,463 C215S probably damaging Het
Cd209b T C 8: 3,918,688 T314A probably benign Het
Cd244 T G 1: 171,581,640 probably null Het
Cdh23 T C 10: 60,413,577 E849G possibly damaging Het
Cep57 A G 9: 13,809,879 V268A probably damaging Het
Clip4 T C 17: 71,856,310 S626P probably damaging Het
Col19a1 C T 1: 24,328,071 G477R probably damaging Het
Col4a4 T C 1: 82,455,728 D1498G unknown Het
Coro6 T C 11: 77,466,496 V177A probably benign Het
Crip3 T C 17: 46,431,284 S202P possibly damaging Het
Cxcr2 T C 1: 74,158,460 C38R probably damaging Het
Cyp4f13 C T 17: 32,929,473 G327R possibly damaging Het
Dab2 C T 15: 6,435,311 Q415* probably null Het
Dennd5b A G 6: 149,068,095 F287L probably benign Het
Dlg4 G A 11: 70,017,231 R6K probably benign Het
Edc4 A G 8: 105,887,401 K429E probably damaging Het
Fam107b T A 2: 3,779,630 probably null Het
Flt4 A T 11: 49,651,070 D1360V probably damaging Het
Gm1043 A T 5: 37,159,824 probably benign Het
Gm35060 G T 18: 32,462,492 probably benign Het
Gm4894 A T 9: 49,278,670 I82L unknown Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gpr176 A C 2: 118,283,904 probably null Het
Gtse1 T C 15: 85,864,180 L262P probably benign Het
Il4ra T C 7: 125,567,221 W46R probably damaging Het
Itga11 A G 9: 62,755,673 Y557C probably benign Het
Kcnab2 A C 4: 152,434,830 probably null Het
Kcnh7 G A 2: 63,184,097 probably benign Het
Ly9 T A 1: 171,601,828 Q230L probably damaging Het
Map2 C A 1: 66,414,884 H978N possibly damaging Het
Map2k6 A G 11: 110,497,906 I225V possibly damaging Het
Map3k13 A G 16: 21,905,245 N326D possibly damaging Het
Mdga2 A G 12: 66,797,763 F85L probably benign Het
Mmp13 C T 9: 7,274,269 P192L probably damaging Het
Mrpl37 T C 4: 107,066,507 T97A probably benign Het
Mycbpap C T 11: 94,513,594 G121D probably benign Het
Nabp1 A G 1: 51,471,385 S153P probably benign Het
Nsun3 A T 16: 62,769,686 F222I probably benign Het
Olfr735 A G 14: 50,345,512 V310A possibly damaging Het
Pcdhga4 A T 18: 37,685,938 D180V probably benign Het
Pex6 C A 17: 46,714,458 probably null Het
Phrf1 C A 7: 141,259,102 probably benign Het
Ppp1r36 A G 12: 76,439,162 T365A possibly damaging Het
Ranbp10 A G 8: 105,773,040 M519T probably benign Het
Rfx4 G A 10: 84,840,017 W32* probably null Het
Ryr1 T C 7: 29,024,241 N4131S probably benign Het
Slc27a6 A G 18: 58,612,234 E580G possibly damaging Het
Slc7a14 T C 3: 31,209,236 D719G probably benign Het
Spice1 A G 16: 44,384,674 E781G probably benign Het
Sspo C T 6: 48,494,176 P4686S possibly damaging Het
Stab1 G T 14: 31,139,551 R2500S probably benign Het
Stox2 A T 8: 47,203,147 M98K possibly damaging Het
Tacc2 T C 7: 130,623,483 S633P probably damaging Het
Tm9sf4 T C 2: 153,195,571 probably null Het
Togaram2 T A 17: 71,704,783 F486I probably damaging Het
Trappc12 A G 12: 28,747,114 S140P possibly damaging Het
Ttc29 A T 8: 78,276,896 N247I probably damaging Het
Uso1 A T 5: 92,192,730 E668D probably benign Het
Vmn2r69 A T 7: 85,411,909 probably null Het
Xirp2 T A 2: 67,511,650 L1412I possibly damaging Het
Xrcc5 T A 1: 72,310,458 D15E probably damaging Het
Zfp661 T C 2: 127,577,048 K391E probably damaging Het
Zfp729b A G 13: 67,593,858 I106T probably benign Het
Zfyve9 A C 4: 108,719,360 S175A probably benign Het
Other mutations in Slfn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slfn9 APN 11 82981371 nonsense probably null
IGL01340:Slfn9 APN 11 82981751 missense probably benign 0.29
IGL01543:Slfn9 APN 11 82987949 missense probably benign
IGL01735:Slfn9 APN 11 82982332 missense probably damaging 1.00
IGL01778:Slfn9 APN 11 82987374 missense probably damaging 0.98
IGL01863:Slfn9 APN 11 82981325 missense probably benign 0.27
IGL01997:Slfn9 APN 11 82987677 missense possibly damaging 0.80
IGL02380:Slfn9 APN 11 82981220 missense probably benign 0.23
IGL02993:Slfn9 APN 11 82981196 missense probably benign 0.18
R1463:Slfn9 UTSW 11 82981698 missense possibly damaging 0.78
R1687:Slfn9 UTSW 11 82982157 missense probably damaging 0.99
R1786:Slfn9 UTSW 11 82981307 missense probably damaging 0.99
R1796:Slfn9 UTSW 11 82981955 missense probably benign 0.00
R1870:Slfn9 UTSW 11 82981576 missense probably benign
R1871:Slfn9 UTSW 11 82981576 missense probably benign
R2004:Slfn9 UTSW 11 82988201 missense probably benign 0.25
R2024:Slfn9 UTSW 11 82981681 missense probably damaging 1.00
R2106:Slfn9 UTSW 11 82987680 missense possibly damaging 0.89
R2140:Slfn9 UTSW 11 82984655 missense possibly damaging 0.76
R3004:Slfn9 UTSW 11 82981764 missense possibly damaging 0.94
R4293:Slfn9 UTSW 11 82982508 missense probably benign 0.01
R4927:Slfn9 UTSW 11 82981390 missense possibly damaging 0.47
R4950:Slfn9 UTSW 11 82981904 missense probably benign
R5471:Slfn9 UTSW 11 82982787 missense possibly damaging 0.85
R5543:Slfn9 UTSW 11 82982381 missense probably damaging 1.00
R5576:Slfn9 UTSW 11 82981432 missense probably benign
R7272:Slfn9 UTSW 11 82981561 missense probably benign 0.36
R7421:Slfn9 UTSW 11 82981371 nonsense probably null
R7421:Slfn9 UTSW 11 82987736 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCATGAAATGGGAGCCTCTG -3'
(R):5'- GAATATGGCCAACGCTTGC -3'

Sequencing Primer
(F):5'- TGGGAGCCTCTGAGAACACTG -3'
(R):5'- AGAGTACATCTCCGCGTT -3'
Posted On2017-06-26