Incidental Mutation 'R5996:4932438A13Rik'
ID481112
Institutional Source Beutler Lab
Gene Symbol 4932438A13Rik
Ensembl Gene ENSMUSG00000037270
Gene NameRIKEN cDNA 4932438A13 gene
SynonymsTweek, FSA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R5996 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36863104-37053033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36931116 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 865 (F865S)
Ref Sequence ENSEMBL: ENSMUSP00000148720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000152564] [ENSMUST00000152881] [ENSMUST00000211820]
Predicted Effect probably benign
Transcript: ENSMUST00000057272
AA Change: F865S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270
AA Change: F865S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123916
Predicted Effect probably benign
Transcript: ENSMUST00000128061
Predicted Effect probably benign
Transcript: ENSMUST00000152564
AA Change: F865S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270
AA Change: F865S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152881
SMART Domains Protein: ENSMUSP00000118366
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211820
AA Change: F865S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,518,928 M1T probably null Het
A2m T A 6: 121,659,394 W741R probably damaging Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acan A G 7: 79,111,320 T1927A probably damaging Het
Agbl4 A G 4: 110,955,672 probably null Het
Ccr8 T A 9: 120,094,463 C215S probably damaging Het
Cd209b T C 8: 3,918,688 T314A probably benign Het
Cd244 T G 1: 171,581,640 probably null Het
Cdh23 T C 10: 60,413,577 E849G possibly damaging Het
Cep57 A G 9: 13,809,879 V268A probably damaging Het
Clip4 T C 17: 71,856,310 S626P probably damaging Het
Col19a1 C T 1: 24,328,071 G477R probably damaging Het
Col4a4 T C 1: 82,455,728 D1498G unknown Het
Coro6 T C 11: 77,466,496 V177A probably benign Het
Crip3 T C 17: 46,431,284 S202P possibly damaging Het
Cxcr2 T C 1: 74,158,460 C38R probably damaging Het
Cyp4f13 C T 17: 32,929,473 G327R possibly damaging Het
Dab2 C T 15: 6,435,311 Q415* probably null Het
Dennd5b A G 6: 149,068,095 F287L probably benign Het
Dlg4 G A 11: 70,017,231 R6K probably benign Het
Edc4 A G 8: 105,887,401 K429E probably damaging Het
Fam107b T A 2: 3,779,630 probably null Het
Flt4 A T 11: 49,651,070 D1360V probably damaging Het
Gm1043 A T 5: 37,159,824 probably benign Het
Gm35060 G T 18: 32,462,492 probably benign Het
Gm4894 A T 9: 49,278,670 I82L unknown Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gpr176 A C 2: 118,283,904 probably null Het
Gtse1 T C 15: 85,864,180 L262P probably benign Het
Il4ra T C 7: 125,567,221 W46R probably damaging Het
Itga11 A G 9: 62,755,673 Y557C probably benign Het
Kcnab2 A C 4: 152,434,830 probably null Het
Kcnh7 G A 2: 63,184,097 probably benign Het
Ly9 T A 1: 171,601,828 Q230L probably damaging Het
Map2 C A 1: 66,414,884 H978N possibly damaging Het
Map2k6 A G 11: 110,497,906 I225V possibly damaging Het
Map3k13 A G 16: 21,905,245 N326D possibly damaging Het
Mdga2 A G 12: 66,797,763 F85L probably benign Het
Mmp13 C T 9: 7,274,269 P192L probably damaging Het
Mrpl37 T C 4: 107,066,507 T97A probably benign Het
Mycbpap C T 11: 94,513,594 G121D probably benign Het
Nabp1 A G 1: 51,471,385 S153P probably benign Het
Nsun3 A T 16: 62,769,686 F222I probably benign Het
Olfr735 A G 14: 50,345,512 V310A possibly damaging Het
Pcdhga4 A T 18: 37,685,938 D180V probably benign Het
Pex6 C A 17: 46,714,458 probably null Het
Phrf1 C A 7: 141,259,102 probably benign Het
Ppp1r36 A G 12: 76,439,162 T365A possibly damaging Het
Ranbp10 A G 8: 105,773,040 M519T probably benign Het
Rfx4 G A 10: 84,840,017 W32* probably null Het
Ryr1 T C 7: 29,024,241 N4131S probably benign Het
Slc27a6 A G 18: 58,612,234 E580G possibly damaging Het
Slc7a14 T C 3: 31,209,236 D719G probably benign Het
Slfn9 A G 11: 82,987,484 I273T possibly damaging Het
Spice1 A G 16: 44,384,674 E781G probably benign Het
Sspo C T 6: 48,494,176 P4686S possibly damaging Het
Stab1 G T 14: 31,139,551 R2500S probably benign Het
Stox2 A T 8: 47,203,147 M98K possibly damaging Het
Tacc2 T C 7: 130,623,483 S633P probably damaging Het
Tm9sf4 T C 2: 153,195,571 probably null Het
Togaram2 T A 17: 71,704,783 F486I probably damaging Het
Trappc12 A G 12: 28,747,114 S140P possibly damaging Het
Ttc29 A T 8: 78,276,896 N247I probably damaging Het
Uso1 A T 5: 92,192,730 E668D probably benign Het
Vmn2r69 A T 7: 85,411,909 probably null Het
Xirp2 T A 2: 67,511,650 L1412I possibly damaging Het
Xrcc5 T A 1: 72,310,458 D15E probably damaging Het
Zfp661 T C 2: 127,577,048 K391E probably damaging Het
Zfp729b A G 13: 67,593,858 I106T probably benign Het
Zfyve9 A C 4: 108,719,360 S175A probably benign Het
Other mutations in 4932438A13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:4932438A13Rik APN 3 37011727 missense probably benign 0.00
IGL00434:4932438A13Rik APN 3 36987299 missense probably damaging 0.98
IGL00640:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00693:4932438A13Rik APN 3 37052547 utr 3 prime probably benign
IGL00721:4932438A13Rik APN 3 37030751 splice site probably null
IGL00756:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00896:4932438A13Rik APN 3 37039462 missense probably benign
IGL00902:4932438A13Rik APN 3 37041345 missense probably damaging 1.00
IGL00980:4932438A13Rik APN 3 37000041 missense probably damaging 1.00
IGL01019:4932438A13Rik APN 3 37006984 critical splice acceptor site probably null
IGL01025:4932438A13Rik APN 3 37046280 missense possibly damaging 0.89
IGL01306:4932438A13Rik APN 3 37005013 splice site probably benign
IGL01370:4932438A13Rik APN 3 36947755 missense probably benign 0.07
IGL01377:4932438A13Rik APN 3 36973452 critical splice donor site probably null
IGL01401:4932438A13Rik APN 3 36942292 missense probably benign
IGL01419:4932438A13Rik APN 3 37048121 missense probably damaging 1.00
IGL01432:4932438A13Rik APN 3 37003759 missense possibly damaging 0.87
IGL01433:4932438A13Rik APN 3 36887770 missense probably damaging 1.00
IGL01452:4932438A13Rik APN 3 36996308 unclassified probably benign
IGL01520:4932438A13Rik APN 3 36973260 nonsense probably null
IGL01524:4932438A13Rik APN 3 36942382 missense possibly damaging 0.90
IGL01628:4932438A13Rik APN 3 37008485 missense probably damaging 1.00
IGL01638:4932438A13Rik APN 3 36974311 missense probably damaging 1.00
IGL01650:4932438A13Rik APN 3 36992673 splice site probably benign
IGL01717:4932438A13Rik APN 3 37034736 missense probably benign
IGL01767:4932438A13Rik APN 3 37041363 missense probably benign 0.29
IGL01813:4932438A13Rik APN 3 36928520 missense possibly damaging 0.90
IGL01998:4932438A13Rik APN 3 36957016 missense possibly damaging 0.49
IGL02172:4932438A13Rik APN 3 37004873 missense probably damaging 0.99
IGL02197:4932438A13Rik APN 3 36906735 missense probably damaging 1.00
IGL02248:4932438A13Rik APN 3 36969290 critical splice donor site probably null
IGL02273:4932438A13Rik APN 3 36921437 splice site probably benign
IGL02403:4932438A13Rik APN 3 37030664 missense probably benign
IGL02492:4932438A13Rik APN 3 37048113 missense probably benign 0.04
IGL02517:4932438A13Rik APN 3 36958868 missense probably damaging 1.00
IGL02519:4932438A13Rik APN 3 36895315 missense probably damaging 1.00
IGL02586:4932438A13Rik APN 3 37044608 nonsense probably null
IGL02620:4932438A13Rik APN 3 37035945 missense possibly damaging 0.95
IGL02621:4932438A13Rik APN 3 37041484 splice site probably benign
IGL02670:4932438A13Rik APN 3 36967305 nonsense probably null
IGL02806:4932438A13Rik APN 3 36946494 missense possibly damaging 0.95
IGL02985:4932438A13Rik APN 3 36958757 missense probably damaging 0.99
IGL03004:4932438A13Rik APN 3 36965677 splice site probably benign
IGL03037:4932438A13Rik APN 3 36969207 missense probably benign 0.23
IGL03037:4932438A13Rik APN 3 36969208 missense probably damaging 1.00
IGL03062:4932438A13Rik APN 3 37038517 splice site probably benign
IGL03137:4932438A13Rik APN 3 37034602 missense probably damaging 0.98
IGL03150:4932438A13Rik APN 3 36948066 missense probably damaging 1.00
IGL03204:4932438A13Rik APN 3 37050934 splice site probably benign
IGL03207:4932438A13Rik APN 3 36949996 missense possibly damaging 0.73
IGL03256:4932438A13Rik APN 3 36906683 splice site probably benign
IGL03264:4932438A13Rik APN 3 37002635 missense probably damaging 1.00
IGL03265:4932438A13Rik APN 3 37047991 missense probably benign 0.00
IGL03303:4932438A13Rik APN 3 36870077 missense possibly damaging 0.90
FR4340:4932438A13Rik UTSW 3 37050752 critical splice acceptor site probably benign
FR4737:4932438A13Rik UTSW 3 37050754 critical splice acceptor site probably benign
R0035:4932438A13Rik UTSW 3 36987598 nonsense probably null
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0092:4932438A13Rik UTSW 3 37028159 missense probably benign 0.41
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0256:4932438A13Rik UTSW 3 36917773 missense probably benign 0.01
R0277:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0321:4932438A13Rik UTSW 3 36906788 splice site probably null
R0323:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0335:4932438A13Rik UTSW 3 36969152 missense probably damaging 1.00
R0375:4932438A13Rik UTSW 3 37046252 missense probably damaging 0.99
R0437:4932438A13Rik UTSW 3 36989804 missense possibly damaging 0.81
R0445:4932438A13Rik UTSW 3 37000065 missense probably damaging 0.99
R0496:4932438A13Rik UTSW 3 36987635 missense probably damaging 1.00
R0531:4932438A13Rik UTSW 3 37036825 missense probably damaging 1.00
R0543:4932438A13Rik UTSW 3 36996458 missense probably benign 0.22
R0545:4932438A13Rik UTSW 3 36987690 splice site probably benign
R0674:4932438A13Rik UTSW 3 37044626 missense possibly damaging 0.86
R0745:4932438A13Rik UTSW 3 36928463 missense probably damaging 1.00
R0755:4932438A13Rik UTSW 3 36946364 missense probably damaging 1.00
R0785:4932438A13Rik UTSW 3 36959334 splice site probably benign
R1056:4932438A13Rik UTSW 3 36983453 missense possibly damaging 0.69
R1056:4932438A13Rik UTSW 3 37044680 missense probably benign 0.44
R1080:4932438A13Rik UTSW 3 36988255 missense probably damaging 1.00
R1103:4932438A13Rik UTSW 3 36996523 missense probably benign
R1119:4932438A13Rik UTSW 3 36987045 missense probably damaging 1.00
R1170:4932438A13Rik UTSW 3 37044631 missense probably damaging 0.98
R1183:4932438A13Rik UTSW 3 36895303 missense possibly damaging 0.51
R1186:4932438A13Rik UTSW 3 36996312 unclassified probably benign
R1201:4932438A13Rik UTSW 3 36948375 missense probably benign
R1219:4932438A13Rik UTSW 3 36946470 nonsense probably null
R1270:4932438A13Rik UTSW 3 36952184 missense probably damaging 1.00
R1273:4932438A13Rik UTSW 3 36987210 missense probably damaging 1.00
R1338:4932438A13Rik UTSW 3 37052535 missense unknown
R1364:4932438A13Rik UTSW 3 36987030 missense probably damaging 1.00
R1437:4932438A13Rik UTSW 3 36942429 missense possibly damaging 0.65
R1447:4932438A13Rik UTSW 3 36965586 missense probably damaging 0.98
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1481:4932438A13Rik UTSW 3 37008434 missense probably damaging 0.99
R1528:4932438A13Rik UTSW 3 37052535 missense unknown
R1533:4932438A13Rik UTSW 3 37041375 missense probably damaging 1.00
R1546:4932438A13Rik UTSW 3 36870056 missense possibly damaging 0.64
R1606:4932438A13Rik UTSW 3 36942399 missense probably damaging 1.00
R1638:4932438A13Rik UTSW 3 37035812 nonsense probably null
R1772:4932438A13Rik UTSW 3 36959432 missense probably damaging 1.00
R1896:4932438A13Rik UTSW 3 36908231 nonsense probably null
R1919:4932438A13Rik UTSW 3 37006983 critical splice acceptor site probably null
R1983:4932438A13Rik UTSW 3 36887865 missense probably null 1.00
R1987:4932438A13Rik UTSW 3 36953985 critical splice donor site probably null
R1992:4932438A13Rik UTSW 3 37000032 missense probably benign 0.32
R1999:4932438A13Rik UTSW 3 36908211 missense probably damaging 1.00
R2004:4932438A13Rik UTSW 3 36895378 missense possibly damaging 0.77
R2010:4932438A13Rik UTSW 3 36928551 missense probably benign 0.09
R2027:4932438A13Rik UTSW 3 37047961 splice site probably benign
R2039:4932438A13Rik UTSW 3 37003878 missense possibly damaging 0.66
R2054:4932438A13Rik UTSW 3 36947853 missense probably benign 0.01
R2089:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36953970 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2220:4932438A13Rik UTSW 3 36875530 critical splice donor site probably null
R2374:4932438A13Rik UTSW 3 36885396 missense probably benign 0.00
R2437:4932438A13Rik UTSW 3 36958685 splice site probably null
R2860:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2861:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2909:4932438A13Rik UTSW 3 36947953 missense probably damaging 1.00
R2925:4932438A13Rik UTSW 3 37007122 missense probably damaging 0.99
R2940:4932438A13Rik UTSW 3 36958805 missense probably damaging 1.00
R3015:4932438A13Rik UTSW 3 36875462 missense probably damaging 1.00
R3086:4932438A13Rik UTSW 3 37011703 missense possibly damaging 0.56
R3159:4932438A13Rik UTSW 3 36959415 missense probably benign 0.17
R3440:4932438A13Rik UTSW 3 37041912 nonsense probably null
R3703:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3705:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3795:4932438A13Rik UTSW 3 37030565 missense probably benign 0.30
R3820:4932438A13Rik UTSW 3 37040434 missense probably damaging 1.00
R3862:4932438A13Rik UTSW 3 36885398 missense possibly damaging 0.73
R3944:4932438A13Rik UTSW 3 37030061 missense possibly damaging 0.90
R4020:4932438A13Rik UTSW 3 37012575 intron probably benign
R4091:4932438A13Rik UTSW 3 37030589 missense probably benign 0.00
R4159:4932438A13Rik UTSW 3 36931083 missense probably benign 0.00
R4231:4932438A13Rik UTSW 3 36920236 missense probably benign 0.10
R4368:4932438A13Rik UTSW 3 36988147 nonsense probably null
R4413:4932438A13Rik UTSW 3 36958681 splice site probably null
R4475:4932438A13Rik UTSW 3 37040395 missense probably damaging 1.00
R4488:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4489:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4516:4932438A13Rik UTSW 3 36895311 missense possibly damaging 0.90
R4580:4932438A13Rik UTSW 3 37030025 missense probably benign 0.02
R4672:4932438A13Rik UTSW 3 36889990 makesense probably null
R4705:4932438A13Rik UTSW 3 37041889 missense probably benign 0.03
R4735:4932438A13Rik UTSW 3 37004967 missense possibly damaging 0.84
R4741:4932438A13Rik UTSW 3 36942375 missense probably damaging 0.99
R4754:4932438A13Rik UTSW 3 37022466 nonsense probably null
R4778:4932438A13Rik UTSW 3 36937065 missense possibly damaging 0.90
R4833:4932438A13Rik UTSW 3 36964968 missense probably damaging 0.96
R4896:4932438A13Rik UTSW 3 36965937 missense probably damaging 1.00
R4910:4932438A13Rik UTSW 3 36998199 missense probably damaging 1.00
R4922:4932438A13Rik UTSW 3 36987165 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36917702 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36919901 missense probably benign 0.41
R4980:4932438A13Rik UTSW 3 36943312 missense probably damaging 1.00
R5030:4932438A13Rik UTSW 3 36943399 intron probably benign
R5049:4932438A13Rik UTSW 3 37040506 intron probably benign
R5049:4932438A13Rik UTSW 3 37041390 missense probably damaging 1.00
R5089:4932438A13Rik UTSW 3 36987502 missense probably benign 0.02
R5092:4932438A13Rik UTSW 3 37000085 missense probably benign 0.14
R5122:4932438A13Rik UTSW 3 37034757 splice site probably null
R5210:4932438A13Rik UTSW 3 37033265 missense possibly damaging 0.85
R5246:4932438A13Rik UTSW 3 37048050 missense probably damaging 1.00
R5289:4932438A13Rik UTSW 3 37000109 missense probably damaging 0.97
R5348:4932438A13Rik UTSW 3 37048146 missense probably damaging 1.00
R5394:4932438A13Rik UTSW 3 36917668 missense probably damaging 1.00
R5434:4932438A13Rik UTSW 3 36875516 missense probably damaging 1.00
R5667:4932438A13Rik UTSW 3 36917677 missense probably benign 0.00
R5686:4932438A13Rik UTSW 3 36917660 missense probably benign 0.00
R5701:4932438A13Rik UTSW 3 36921360 missense probably benign 0.10
R5778:4932438A13Rik UTSW 3 36958714 missense probably damaging 1.00
R5787:4932438A13Rik UTSW 3 36992733 unclassified probably null
R5800:4932438A13Rik UTSW 3 37052443 missense probably damaging 1.00
R5819:4932438A13Rik UTSW 3 37048600 missense probably benign 0.12
R5820:4932438A13Rik UTSW 3 37039526 missense probably benign 0.00
R5952:4932438A13Rik UTSW 3 36965621 missense probably damaging 1.00
R5975:4932438A13Rik UTSW 3 36969221 missense possibly damaging 0.64
R6192:4932438A13Rik UTSW 3 36988169 missense probably benign 0.00
R6225:4932438A13Rik UTSW 3 36948304 missense probably damaging 1.00
R6234:4932438A13Rik UTSW 3 36983471 missense probably benign 0.00
R6244:4932438A13Rik UTSW 3 36956999 missense probably benign
R6263:4932438A13Rik UTSW 3 36931111 missense probably benign 0.06
R6351:4932438A13Rik UTSW 3 36908228 missense probably damaging 1.00
R6380:4932438A13Rik UTSW 3 37033307 missense probably benign 0.19
R6468:4932438A13Rik UTSW 3 37008443 missense probably damaging 1.00
R6759:4932438A13Rik UTSW 3 36988085 missense possibly damaging 0.81
R6792:4932438A13Rik UTSW 3 37011566 critical splice acceptor site probably null
R6809:4932438A13Rik UTSW 3 36874282 missense probably damaging 0.98
R6841:4932438A13Rik UTSW 3 37021481 missense probably damaging 1.00
R6959:4932438A13Rik UTSW 3 36967189 missense probably damaging 1.00
X0050:4932438A13Rik UTSW 3 36957128 missense probably damaging 1.00
Z1088:4932438A13Rik UTSW 3 36987567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCATAGCAGAGGTCACC -3'
(R):5'- CTCTACAAACAGCTATTCTATGTCCAC -3'

Sequencing Primer
(F):5'- CTTATGTTGTTCAAAAGGGGACAG -3'
(R):5'- TGTCCACATATATAAAACACAGTGG -3'
Posted On2017-06-26