Incidental Mutation 'R5987:Gcc2'
ID481745
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
MMRRC Submission 044167-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5987 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) G to T at 58255847 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160427] [ENSMUST00000162041] [ENSMUST00000162860] [ENSMUST00000162984]
Predicted Effect unknown
Transcript: ENSMUST00000057659
AA Change: V9L
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: V9L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160427
SMART Domains Protein: ENSMUSP00000124411
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 32 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161570
Predicted Effect probably benign
Transcript: ENSMUST00000162041
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162860
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162984
AA Change: V9L
SMART Domains Protein: ENSMUSP00000124988
Gene: ENSMUSG00000038039
AA Change: V9L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,258,098 L2411R probably damaging Het
Als2 A G 1: 59,206,587 W577R probably damaging Het
Aox2 C A 1: 58,307,359 R551S probably benign Het
Areg A T 5: 91,146,718 H245L possibly damaging Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Arhgef28 A T 13: 97,936,860 C1322* probably null Het
Arhgef38 T C 3: 133,206,958 R107G possibly damaging Het
Atf7ip T A 6: 136,571,502 F695L probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Bche T G 3: 73,648,678 Q549P possibly damaging Het
Blnk A G 19: 40,929,289 F417L possibly damaging Het
Bloc1s1 T G 10: 128,923,386 K17T probably damaging Het
C330018D20Rik G T 18: 56,957,896 T65K probably damaging Het
Cers1 T A 8: 70,321,578 S162T possibly damaging Het
Cgn T C 3: 94,779,522 K157E probably benign Het
Cldn7 G A 11: 69,967,668 R196Q probably benign Het
Clrn2 C A 5: 45,454,027 Q73K probably benign Het
Cmss1 A G 16: 57,302,245 V262A probably benign Het
Cpb2 T A 14: 75,260,688 V97E probably damaging Het
Ctnnd2 G A 15: 30,683,241 V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 S416R probably benign Het
Dip2b C T 15: 100,190,079 R965C probably damaging Het
Dkk3 T C 7: 112,150,658 T102A probably benign Het
Dmap1 C A 4: 117,680,842 probably null Het
Dnah12 C A 14: 26,886,871 D3872E possibly damaging Het
Dnah7b A G 1: 46,119,398 probably null Het
Dnaic1 C T 4: 41,632,391 T575I probably benign Het
Dsg1a T A 18: 20,331,542 Y365N probably damaging Het
Dusp11 T A 6: 85,959,233 K18* probably null Het
E2f2 A T 4: 136,172,934 T52S probably benign Het
Elavl4 A G 4: 110,290,644 L13S probably benign Het
Epor T C 9: 21,962,276 D59G possibly damaging Het
Eral1 A G 11: 78,080,233 C43R possibly damaging Het
Fam135b A G 15: 71,490,848 V228A probably benign Het
Gba T C 3: 89,205,822 S187P probably damaging Het
Gdap2 C A 3: 100,202,256 probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm8251 A T 1: 44,057,257 N1560K probably benign Het
Gpr160 T C 3: 30,896,463 L228P probably benign Het
Gsdmc2 A C 15: 63,830,866 V184G probably benign Het
Gtf2e2 A T 8: 33,776,052 K252M probably damaging Het
Gtf2e2 G T 8: 33,776,053 K252N probably benign Het
Gys1 T C 7: 45,438,105 Y102H probably benign Het
Hist1h4b A G 13: 23,757,226 D69G probably damaging Het
Ifit3b A C 19: 34,612,198 D258A probably damaging Het
Itpr3 T A 17: 27,104,601 M1200K probably damaging Het
Kcng4 A T 8: 119,626,359 F271I probably damaging Het
Klhdc2 C T 12: 69,303,613 S144L possibly damaging Het
Lhcgr A G 17: 88,755,578 F222S probably damaging Het
Lrp5 C G 19: 3,628,299 G519R probably damaging Het
Magel2 T C 7: 62,378,767 V473A probably benign Het
Map1a T C 2: 121,304,295 V1864A possibly damaging Het
Mast4 T A 13: 102,758,734 Q760H probably damaging Het
Mertk A G 2: 128,771,374 N437D probably benign Het
Mettl18 G A 1: 163,996,775 V222I probably benign Het
Mical2 C T 7: 112,334,948 T782M probably benign Het
Mocos T A 18: 24,686,693 V664E probably damaging Het
Neb G T 2: 52,295,294 N975K probably benign Het
Nectin3 A T 16: 46,464,145 S59T probably benign Het
Nelfb A T 2: 25,203,888 M11K probably damaging Het
Nrp1 A G 8: 128,476,169 N545S probably damaging Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1333 T C 4: 118,830,281 D53G probably damaging Het
Olfr1472 A T 19: 13,453,960 S186T possibly damaging Het
Olfr492 T A 7: 108,323,047 T210S probably benign Het
Olfr66 T A 7: 103,881,700 D181V probably damaging Het
Olfr814 A T 10: 129,874,521 F79I probably damaging Het
Olfr968 T C 9: 39,772,540 T87A probably benign Het
P3h1 A G 4: 119,246,665 H587R probably damaging Het
Paqr4 A G 17: 23,739,858 probably null Het
Pde12 A G 14: 26,669,098 V152A probably benign Het
Ppip5k1 C A 2: 121,350,491 E45* probably null Het
Ptch2 C T 4: 117,110,057 A677V probably benign Het
Rgs12 A G 5: 35,020,345 N93S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Robo4 A G 9: 37,411,400 I850V probably damaging Het
Scap T A 9: 110,381,151 I876N probably damaging Het
Sin3a A G 9: 57,127,200 D1219G possibly damaging Het
Skint5 T C 4: 113,885,808 E354G unknown Het
Spg20 A G 3: 55,126,541 D396G probably benign Het
Spindoc G A 19: 7,373,659 S311L probably benign Het
Spta1 G T 1: 174,223,328 R1791L probably damaging Het
Tbck T C 3: 132,801,517 I750T possibly damaging Het
Tcrg-V1 A T 13: 19,340,304 Y66F probably benign Het
Tmem191c T C 16: 17,276,470 probably null Het
Vmn2r125 A G 4: 156,349,997 Y26C probably damaging Het
Zbtb17 T C 4: 141,464,817 C358R possibly damaging Het
Zfp180 G A 7: 24,105,434 G426E probably damaging Het
Zfp445 A G 9: 122,853,886 V330A probably benign Het
Zfp595 A G 13: 67,317,624 C192R probably damaging Het
Zkscan4 A G 13: 21,484,453 H387R probably damaging Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5224:Gcc2 UTSW 10 58286160 missense probably damaging 1.00
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6331:Gcc2 UTSW 10 58271465 missense probably benign
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 unclassified probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6774:Gcc2 UTSW 10 58281439 missense possibly damaging 0.94
R6808:Gcc2 UTSW 10 58258242 missense probably damaging 0.99
R7072:Gcc2 UTSW 10 58270927 missense probably benign 0.02
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7441:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7543:Gcc2 UTSW 10 58271264 missense probably benign 0.02
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGCATTGAACCTGGTGC -3'
(R):5'- CAGGAAGTAAACAAACTGCTCG -3'

Sequencing Primer
(F):5'- CATTGAACCTGGTGCTGGCTC -3'
(R):5'- AACTGCTCGCACATCAGG -3'
Posted On2017-06-26