Incidental Mutation 'R6074:Col19a1'
ID482616
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission 044235-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6074 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24526483 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 256 (T256S)
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect unknown
Transcript: ENSMUST00000051344
AA Change: T256S
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141
AA Change: T256S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115244
AA Change: T256S
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: T256S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 T A 3: 108,191,693 C189* probably null Het
Auts2 G T 5: 131,476,989 probably benign Het
Cadps2 C A 6: 23,626,671 W177L probably damaging Het
Camk2b G T 11: 5,989,635 P223Q probably damaging Het
Ccdc74a C A 16: 17,646,727 S9* probably null Het
Ccnt1 A C 15: 98,543,324 Y688D probably damaging Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ceacam3 C T 7: 17,151,559 T29I probably benign Het
Cep170b T C 12: 112,744,155 S1473P probably damaging Het
Eif2d T A 1: 131,166,342 D423E probably damaging Het
Fam13a A G 6: 58,989,738 probably null Het
Fam84a G A 12: 14,150,511 H72Y probably benign Het
Gaa G A 11: 119,284,186 R871H probably benign Het
Galnt12 T A 4: 47,112,405 V37D probably damaging Het
Glp2r A G 11: 67,746,814 S13P unknown Het
Gnptab C T 10: 88,433,078 L548F probably damaging Het
Heg1 C T 16: 33,727,203 P787S possibly damaging Het
Hivep2 T A 10: 14,131,741 M1361K probably benign Het
Hivep3 T C 4: 120,097,694 I1069T possibly damaging Het
Hspg2 A G 4: 137,540,735 D2121G probably benign Het
Htatip2 A G 7: 49,772,574 probably null Het
Ighv1-75 T C 12: 115,834,387 S4G probably benign Het
Ip6k1 A G 9: 108,024,109 probably benign Het
Kcna6 A G 6: 126,739,279 S216P probably benign Het
Kif21a T A 15: 90,980,892 T526S probably benign Het
Kng2 C T 16: 23,000,596 G230D probably benign Het
Lgi2 A T 5: 52,546,642 F216I probably benign Het
Lss T A 10: 76,543,859 N383K probably damaging Het
Mical1 T C 10: 41,486,065 M929T probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nat8f4 A G 6: 85,901,187 V118A probably damaging Het
Olfr1198 A C 2: 88,746,222 L222R probably damaging Het
Olfr1416 G A 1: 92,479,775 T282M probably benign Het
Olfr16 T A 1: 172,957,378 N194K probably benign Het
Osbpl11 T A 16: 33,209,965 S188T probably benign Het
Pea15a C T 1: 172,199,185 R85H possibly damaging Het
Ppp1r13b A G 12: 111,832,402 I919T probably damaging Het
Rasgrf1 A G 9: 89,953,915 D232G probably benign Het
Rp1 A G 1: 4,345,379 S1837P probably benign Het
Samd5 T A 10: 9,674,590 Y125F possibly damaging Het
Skint5 T C 4: 113,805,200 T597A unknown Het
Slc25a12 A G 2: 71,276,454 F605L probably benign Het
Slc39a12 C T 2: 14,407,479 Q321* probably null Het
Slc6a19 T C 13: 73,689,763 S206G probably benign Het
Tacc2 T A 7: 130,625,435 H1283Q possibly damaging Het
Thumpd3 A G 6: 113,060,010 E290G possibly damaging Het
Timd2 C T 11: 46,687,172 G44D possibly damaging Het
Tmem74 A G 15: 43,866,738 V303A possibly damaging Het
Tpo A G 12: 30,078,187 V785A probably benign Het
Tpra1 T A 6: 88,911,937 I367N possibly damaging Het
Txnrd2 T C 16: 18,437,547 I95T probably damaging Het
Usp32 A G 11: 84,994,573 V1216A probably benign Het
Usp54 C A 14: 20,552,099 M1394I probably benign Het
Vmn2r13 A G 5: 109,174,301 F177L probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Wdfy4 C T 14: 33,083,639 probably null Het
Wnk2 A T 13: 49,051,399 C458S probably damaging Het
Xkr6 T G 14: 63,607,070 F181V possibly damaging Het
Zfp212 T A 6: 47,927,052 C149* probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp661 A G 2: 127,577,873 S116P probably benign Het
Zfp770 A G 2: 114,196,389 Y400H possibly damaging Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATTTGACTAGGCATGAGGC -3'
(R):5'- ACACTGCAGGCTTAGTGATAG -3'

Posted On2017-07-14