Incidental Mutation 'R6133:Mex3d'
ID487244
Institutional Source Beutler Lab
Gene Symbol Mex3d
Ensembl Gene ENSMUSG00000048696
Gene Namemex3 RNA binding family member D
SynonymsRkhd1
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R6133 (G1)
Quality Score192.009
Status Validated
Chromosome10
Chromosomal Location80380355-80387659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80386786 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 212 (L212P)
Ref Sequence ENSEMBL: ENSMUSP00000100987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105350]
Predicted Effect probably benign
Transcript: ENSMUST00000062946
AA Change: L212P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057962
Gene: ENSMUSG00000048696
AA Change: L212P

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 30 65 N/A INTRINSIC
internal_repeat_1 88 132 4.63e-12 PROSPERO
internal_repeat_1 130 174 4.63e-12 PROSPERO
low complexity region 185 201 N/A INTRINSIC
KH 232 300 6.8e-10 SMART
KH 327 394 4.45e-14 SMART
low complexity region 463 495 N/A INTRINSIC
low complexity region 570 585 N/A INTRINSIC
low complexity region 606 631 N/A INTRINSIC
low complexity region 642 664 N/A INTRINSIC
RING 667 706 7.34e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105350
AA Change: L212P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100987
Gene: ENSMUSG00000048696
AA Change: L212P

DomainStartEndE-ValueType
internal_repeat_2 3 25 3.12e-8 PROSPERO
internal_repeat_1 5 34 7.48e-13 PROSPERO
internal_repeat_1 41 70 7.48e-13 PROSPERO
internal_repeat_2 51 73 3.12e-8 PROSPERO
low complexity region 78 94 N/A INTRINSIC
KH 125 193 6.8e-10 SMART
KH 220 287 4.45e-14 SMART
low complexity region 356 388 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
low complexity region 535 557 N/A INTRINSIC
RING 560 599 7.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122709
Predicted Effect probably benign
Transcript: ENSMUST00000123141
SMART Domains Protein: ENSMUSP00000115410
Gene: ENSMUSG00000048696

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
low complexity region 178 200 N/A INTRINSIC
RING 203 242 7.34e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Frmpd1 T A 4: 45,284,915 H1245Q probably benign Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Mex3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Mex3d APN 10 80382035 missense possibly damaging 0.49
R0316:Mex3d UTSW 10 80381671 missense probably damaging 0.97
R0401:Mex3d UTSW 10 80386894 missense probably benign 0.33
R0734:Mex3d UTSW 10 80381532 missense possibly damaging 0.55
R0894:Mex3d UTSW 10 80381542 missense probably benign 0.04
R1452:Mex3d UTSW 10 80381520 missense probably damaging 0.99
R1764:Mex3d UTSW 10 80386936 missense probably benign 0.15
R1795:Mex3d UTSW 10 80381542 missense probably benign 0.04
R4801:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R4802:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R5632:Mex3d UTSW 10 80382594 missense probably damaging 1.00
R5701:Mex3d UTSW 10 80381545 missense probably benign 0.00
R5964:Mex3d UTSW 10 80382587 missense probably damaging 1.00
R6414:Mex3d UTSW 10 80381371 missense unknown
R6938:Mex3d UTSW 10 80382240 missense possibly damaging 0.61
R7154:Mex3d UTSW 10 80386750 missense
R7241:Mex3d UTSW 10 80387257 missense
Predicted Primers PCR Primer
(F):5'- TTATCCAGGAGAATAAGCGCGC -3'
(R):5'- TGACTTGTGCACCCTCGATG -3'

Sequencing Primer
(F):5'- AGAATAAGCGCGCCCCTG -3'
(R):5'- TCGGTGACTTGTGCACC -3'
Posted On2017-10-10