Mutagenetix > Incidental Mutation

Incidental Mutation 'R6133:Ankhd1'

487256

Institutional Source

Beutler Lab

Gene Symbol

Ankhd1

Ensembl Gene

ENSMUSG00000024483

Gene Name

ankyrin repeat and KH domain containing 1

Synonyms

A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik

MMRRC Submission

044280-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36693656-36791961 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36758179 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 958 (S958P)

Ref Sequence

ENSEMBL: ENSMUSP00000123270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]

AlphaFold

E9PUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000006205
AA Change: S958P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: S958P

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136030

SMART Domains

Protein: ENSMUSP00000115837
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
ANK	94	123	2.07e-2	SMART
ANK	127	156	2.48e-5	SMART
ANK	161	190	3.85e-2	SMART
ANK	194	219	4.23e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142780

Predicted Effect

probably benign
Transcript: ENSMUST00000142977
AA Change: S958P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: S958P

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152060

SMART Domains

Protein: ENSMUSP00000116047
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
ANK	1	28	1.6e1	SMART
ANK	32	61	4.56e-4	SMART
ANK	66	95	9.64e-3	SMART
ANK	99	128	6.71e-2	SMART
coiled coil region	227	267	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155329
AA Change: S958P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: S958P

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2342	2362	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156424

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	A	G	8: 89,052,067 (GRCm39)	T912A	possibly damaging	Het
Akap12	G	T	10: 4,305,178 (GRCm39)	G663C	probably benign	Het
Cmtm2a	T	C	8: 105,019,362 (GRCm39)	I76V	probably benign	Het
Cpxm2	G	A	7: 131,730,182 (GRCm39)	P146S	probably damaging	Het
Cubn	A	G	2: 13,313,429 (GRCm39)	V3047A	probably benign	Het
Dgkd	T	A	1: 87,865,962 (GRCm39)	V198E	possibly damaging	Het
Dnah3	A	T	7: 119,685,469 (GRCm39)	M181K	probably benign	Het
Dnah7a	T	C	1: 53,458,814 (GRCm39)	T3775A	probably benign	Het
Dsg2	A	G	18: 20,723,146 (GRCm39)	I391V	probably benign	Het
Ebi3	T	A	17: 56,261,311 (GRCm39)	V69E	probably benign	Het
Fn1	T	C	1: 71,636,886 (GRCm39)	T1998A	probably damaging	Het
Frmpd1	T	A	4: 45,284,915 (GRCm39)	H1245Q	probably benign	Het
Gm7145	T	A	1: 117,913,618 (GRCm39)	C167S	probably damaging	Het
Hydin	C	T	8: 111,327,908 (GRCm39)	T4805I	probably benign	Het
Itgb4	C	T	11: 115,874,983 (GRCm39)	R447W	probably benign	Het
Kcnma1	C	T	14: 24,053,936 (GRCm39)	M21I	probably damaging	Het
Lrfn5	A	G	12: 61,890,574 (GRCm39)	D621G	probably benign	Het
Lrrc15	C	T	16: 30,093,054 (GRCm39)	G95D	probably benign	Het
Mex3d	A	G	10: 80,222,620 (GRCm39)	L212P	probably damaging	Het
Mmel1	C	T	4: 154,979,475 (GRCm39)	H728Y	probably damaging	Het
Naip1	A	G	13: 100,581,151 (GRCm39)	V32A	probably benign	Het
Nsl1	T	C	1: 190,803,403 (GRCm39)	L158P	probably damaging	Het
Or51q1c	A	T	7: 103,652,532 (GRCm39)	T17S	possibly damaging	Het
Or6c202	G	A	10: 128,996,752 (GRCm39)	L34F	possibly damaging	Het
Or8b36	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 37,937,836 (GRCm39)		probably null	Het
Pakap	C	T	4: 57,855,516 (GRCm39)	Q525*	probably null	Het
Pcdh15	A	T	10: 74,481,805 (GRCm39)		probably null	Het
Pramel15	T	C	4: 144,104,347 (GRCm39)	R53G	possibly damaging	Het
Ptpn1	T	C	2: 167,809,716 (GRCm39)	V108A	possibly damaging	Het
Rad9b	T	C	5: 122,477,831 (GRCm39)	N182D	possibly damaging	Het
Rp1l1	C	T	14: 64,267,545 (GRCm39)	P1044S	probably damaging	Het
Scn2a	G	A	2: 65,573,448 (GRCm39)	V1433I	probably benign	Het
Ssrp1	T	G	2: 84,875,683 (GRCm39)		probably benign	Het
Suco	T	A	1: 161,662,752 (GRCm39)	K560*	probably null	Het
Tbx3	T	C	5: 119,819,018 (GRCm39)	V531A	probably benign	Het
Tmem30c	T	C	16: 57,098,100 (GRCm39)	Y107C	probably damaging	Het
Topbp1	T	A	9: 103,188,963 (GRCm39)		probably null	Het
Trpm5	A	T	7: 142,642,688 (GRCm39)	D86E	probably damaging	Het
Urb2	C	T	8: 124,755,300 (GRCm39)	Q336*	probably null	Het
Vmn2r43	A	G	7: 8,247,970 (GRCm39)	F731S	probably damaging	Het
Xkr9	A	G	1: 13,754,359 (GRCm39)	T118A	probably benign	Het
Zcchc2	A	C	1: 105,947,609 (GRCm39)	K117N	probably damaging	Het
Zfp52	T	C	17: 21,780,733 (GRCm39)	Y194H	probably damaging	Het
Zfp763	C	T	17: 33,237,675 (GRCm39)	C490Y	possibly damaging	Het
Zmynd19	G	T	2: 24,848,131 (GRCm39)	R148L	possibly damaging	Het

Other mutations in Ankhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ankhd1	APN	18	36,798,512 (GRCm39)	unclassified	probably benign
IGL00927:Ankhd1	APN	18	36,765,125 (GRCm39)	missense	probably benign	0.01
IGL01367:Ankhd1	APN	18	36,711,696 (GRCm39)	missense	probably benign	0.16
IGL01624:Ankhd1	APN	18	36,791,066 (GRCm39)	missense	probably damaging	1.00
IGL01725:Ankhd1	APN	18	36,781,206 (GRCm39)	missense	probably benign	0.04
IGL01767:Ankhd1	APN	18	36,781,427 (GRCm39)	missense	probably damaging	1.00
IGL02005:Ankhd1	APN	18	36,781,479 (GRCm39)	missense	probably damaging	1.00
IGL02009:Ankhd1	APN	18	36,757,714 (GRCm39)	missense	probably damaging	1.00
IGL02246:Ankhd1	APN	18	36,789,779 (GRCm39)	missense	probably damaging	1.00
IGL02336:Ankhd1	APN	18	36,727,867 (GRCm39)	missense	probably damaging	0.97
IGL02628:Ankhd1	APN	18	36,780,756 (GRCm39)	missense	probably benign	0.00
IGL02644:Ankhd1	APN	18	36,711,828 (GRCm39)	critical splice donor site	probably null
IGL02735:Ankhd1	APN	18	36,781,599 (GRCm39)	missense	probably benign	0.00
IGL02877:Ankhd1	APN	18	36,727,876 (GRCm39)	missense	probably damaging	1.00
IGL03129:Ankhd1	APN	18	36,791,061 (GRCm39)	nonsense	probably null
IGL03163:Ankhd1	APN	18	36,780,681 (GRCm39)	missense	probably damaging	0.97
IGL03182:Ankhd1	APN	18	36,711,827 (GRCm39)	missense	probably benign	0.06
IGL03184:Ankhd1	APN	18	36,780,830 (GRCm39)	missense	probably damaging	1.00
IGL03398:Ankhd1	APN	18	36,789,890 (GRCm39)	splice site	probably benign
FR4304:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
R0051:Ankhd1	UTSW	18	36,780,241 (GRCm39)	unclassified	probably benign
R0089:Ankhd1	UTSW	18	36,773,409 (GRCm39)	missense	probably damaging	0.99
R0105:Ankhd1	UTSW	18	36,779,819 (GRCm39)	missense	probably damaging	1.00
R0149:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0243:Ankhd1	UTSW	18	36,767,787 (GRCm39)	missense	probably damaging	1.00
R0322:Ankhd1	UTSW	18	36,791,061 (GRCm39)	nonsense	probably null
R0361:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0389:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0418:Ankhd1	UTSW	18	36,767,353 (GRCm39)	missense	probably damaging	1.00
R0443:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0540:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0607:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0738:Ankhd1	UTSW	18	36,778,302 (GRCm39)	splice site	probably benign
R1127:Ankhd1	UTSW	18	36,767,399 (GRCm39)	missense	probably damaging	1.00
R1434:Ankhd1	UTSW	18	36,758,212 (GRCm39)	missense	probably benign	0.09
R1742:Ankhd1	UTSW	18	36,758,318 (GRCm39)	missense	probably damaging	1.00
R1776:Ankhd1	UTSW	18	36,780,361 (GRCm39)	missense	probably benign	0.17
R1856:Ankhd1	UTSW	18	36,777,580 (GRCm39)	missense	probably benign	0.00
R1923:Ankhd1	UTSW	18	36,781,083 (GRCm39)	missense	probably benign	0.08
R2044:Ankhd1	UTSW	18	36,778,166 (GRCm39)	missense	probably benign	0.31
R2112:Ankhd1	UTSW	18	36,774,679 (GRCm39)	missense	probably damaging	1.00
R2115:Ankhd1	UTSW	18	36,767,361 (GRCm39)	missense	probably damaging	1.00
R2136:Ankhd1	UTSW	18	36,780,674 (GRCm39)	missense	probably benign
R2196:Ankhd1	UTSW	18	36,781,432 (GRCm39)	missense	probably damaging	1.00
R2291:Ankhd1	UTSW	18	36,777,386 (GRCm39)	missense	probably benign	0.31
R2305:Ankhd1	UTSW	18	36,775,979 (GRCm39)	missense	possibly damaging	0.59
R2309:Ankhd1	UTSW	18	36,757,818 (GRCm39)	missense	probably damaging	1.00
R2519:Ankhd1	UTSW	18	36,711,596 (GRCm39)	splice site	probably null
R2958:Ankhd1	UTSW	18	36,767,782 (GRCm39)	missense	probably damaging	1.00
R3978:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R3980:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R4159:Ankhd1	UTSW	18	36,722,593 (GRCm39)	missense	possibly damaging	0.91
R4199:Ankhd1	UTSW	18	36,794,101 (GRCm39)	unclassified	probably benign
R4323:Ankhd1	UTSW	18	36,711,686 (GRCm39)	missense	probably damaging	1.00
R4356:Ankhd1	UTSW	18	36,776,096 (GRCm39)	nonsense	probably null
R4496:Ankhd1	UTSW	18	36,693,839 (GRCm39)	missense	probably damaging	0.98
R4551:Ankhd1	UTSW	18	36,788,560 (GRCm39)	splice site	probably null
R4590:Ankhd1	UTSW	18	36,716,697 (GRCm39)	missense	probably damaging	1.00
R4667:Ankhd1	UTSW	18	36,781,074 (GRCm39)	missense	possibly damaging	0.77
R4889:Ankhd1	UTSW	18	36,711,787 (GRCm39)	missense	probably null	0.00
R4923:Ankhd1	UTSW	18	36,722,505 (GRCm39)	missense	probably damaging	1.00
R5091:Ankhd1	UTSW	18	36,758,080 (GRCm39)	missense	possibly damaging	0.68
R5254:Ankhd1	UTSW	18	36,789,768 (GRCm39)	missense	probably benign	0.05
R5314:Ankhd1	UTSW	18	36,694,111 (GRCm39)	splice site	probably null
R5336:Ankhd1	UTSW	18	36,779,769 (GRCm39)	missense	probably damaging	1.00
R5367:Ankhd1	UTSW	18	36,722,461 (GRCm39)	missense	probably damaging	1.00
R5384:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5385:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5387:Ankhd1	UTSW	18	36,767,697 (GRCm39)	missense	probably damaging	1.00
R5458:Ankhd1	UTSW	18	36,781,538 (GRCm39)	missense	probably benign	0.01
R5599:Ankhd1	UTSW	18	36,693,860 (GRCm39)	missense	probably damaging	0.98
R5659:Ankhd1	UTSW	18	36,694,103 (GRCm39)	missense	probably damaging	1.00
R5750:Ankhd1	UTSW	18	36,757,955 (GRCm39)	missense	probably benign	0.00
R5874:Ankhd1	UTSW	18	36,773,322 (GRCm39)	missense	possibly damaging	0.92
R5894:Ankhd1	UTSW	18	36,780,577 (GRCm39)	missense	probably damaging	0.99
R5969:Ankhd1	UTSW	18	36,733,887 (GRCm39)	missense	probably damaging	1.00
R6190:Ankhd1	UTSW	18	36,744,862 (GRCm39)	missense	possibly damaging	0.84
R6247:Ankhd1	UTSW	18	36,787,199 (GRCm39)	missense	probably benign	0.00
R6512:Ankhd1	UTSW	18	36,724,509 (GRCm39)	missense	probably damaging	1.00
R6649:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6653:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6763:Ankhd1	UTSW	18	36,776,022 (GRCm39)	missense	probably benign	0.31
R6976:Ankhd1	UTSW	18	36,781,307 (GRCm39)	missense	probably benign	0.00
R7075:Ankhd1	UTSW	18	36,693,042 (GRCm39)	missense
R7208:Ankhd1	UTSW	18	36,758,081 (GRCm39)	missense	probably benign
R7305:Ankhd1	UTSW	18	36,765,258 (GRCm39)	missense
R7615:Ankhd1	UTSW	18	36,789,826 (GRCm39)	missense
R7654:Ankhd1	UTSW	18	36,727,154 (GRCm39)	missense	probably damaging	1.00
R7781:Ankhd1	UTSW	18	36,758,258 (GRCm39)	missense	probably damaging	1.00
R7842:Ankhd1	UTSW	18	36,780,881 (GRCm39)	missense	probably benign	0.00
R7965:Ankhd1	UTSW	18	36,791,465 (GRCm39)	missense
R8006:Ankhd1	UTSW	18	36,781,772 (GRCm39)	missense
R8037:Ankhd1	UTSW	18	36,771,676 (GRCm39)	missense	probably damaging	0.98
R8123:Ankhd1	UTSW	18	36,708,136 (GRCm39)	missense
R8195:Ankhd1	UTSW	18	36,787,230 (GRCm39)	missense
R8305:Ankhd1	UTSW	18	36,780,219 (GRCm39)	missense	possibly damaging	0.79
R8708:Ankhd1	UTSW	18	36,727,344 (GRCm39)	missense	probably damaging	1.00
R8827:Ankhd1	UTSW	18	36,757,633 (GRCm39)	nonsense	probably null
R9138:Ankhd1	UTSW	18	36,693,961 (GRCm39)	small deletion	probably benign
R9139:Ankhd1	UTSW	18	36,711,810 (GRCm39)	missense
R9186:Ankhd1	UTSW	18	36,767,383 (GRCm39)	missense	possibly damaging	0.95
R9245:Ankhd1	UTSW	18	36,788,653 (GRCm39)	missense
R9254:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9262:Ankhd1	UTSW	18	36,765,799 (GRCm39)	missense
R9379:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9436:Ankhd1	UTSW	18	36,774,654 (GRCm39)	missense	probably benign	0.04
R9436:Ankhd1	UTSW	18	36,694,041 (GRCm39)	missense	probably benign	0.39
R9541:Ankhd1	UTSW	18	36,757,697 (GRCm39)	missense
R9584:Ankhd1	UTSW	18	36,798,504 (GRCm39)	missense	probably benign	0.06
R9664:Ankhd1	UTSW	18	36,780,878 (GRCm39)	missense	probably benign	0.03
RF001:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF004:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF007:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF008:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
RF009:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF013:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF017:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF018:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF026:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,966 (GRCm39)	small insertion	probably benign
RF039:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
RF043:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF046:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF049:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF050:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF054:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF057:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF060:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF061:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF062:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
X0027:Ankhd1	UTSW	18	36,757,885 (GRCm39)	missense	probably damaging	1.00
X0065:Ankhd1	UTSW	18	36,711,817 (GRCm39)	nonsense	probably null
X0066:Ankhd1	UTSW	18	36,779,757 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCCCAGCTTGATACAGTC -3'
(R):5'- GCTAGTGCTACTGGGCTTAC -3'

Sequencing Primer
(F):5'- CCAGCTTGATACAGTCTTATTTAAGG -3'
(R):5'- GTGCTACTGGGCTTACTTAAATTCAC -3'

Posted On

2017-10-10