Incidental Mutation 'R6133:Frmpd1'
ID487225
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission 044280-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6133 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45284915 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1245 (H1245Q)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably benign
Transcript: ENSMUST00000044773
AA Change: H1245Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: H1245Q

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107804
AA Change: H1245Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: H1245Q

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 A G 8: 88,325,439 T912A possibly damaging Het
Akap12 G T 10: 4,355,178 G663C probably benign Het
Akap2 C T 4: 57,855,516 Q525* probably null Het
Ankhd1 T C 18: 36,625,126 S958P possibly damaging Het
Cmtm2a T C 8: 104,292,730 I76V probably benign Het
Cpxm2 G A 7: 132,128,453 P146S probably damaging Het
Cubn A G 2: 13,308,618 V3047A probably benign Het
Dgkd T A 1: 87,938,240 V198E possibly damaging Het
Dnah3 A T 7: 120,086,246 M181K probably benign Het
Dnah7a T C 1: 53,419,655 T3775A probably benign Het
Dsg2 A G 18: 20,590,089 I391V probably benign Het
Ebi3 T A 17: 55,954,311 V69E probably benign Het
Fn1 T C 1: 71,597,727 T1998A probably damaging Het
Gm7145 T A 1: 117,985,888 C167S probably damaging Het
Hydin C T 8: 110,601,276 T4805I probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 C T 14: 24,003,868 M21I probably damaging Het
Lrfn5 A G 12: 61,843,788 D621G probably benign Het
Lrrc15 C T 16: 30,274,236 G95D probably benign Het
Mex3d A G 10: 80,386,786 L212P probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Naip1 A G 13: 100,444,643 V32A probably benign Het
Nsl1 T C 1: 191,071,206 L158P probably damaging Het
Olfr638 A T 7: 104,003,325 T17S possibly damaging Het
Olfr771 G A 10: 129,160,883 L34F possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pcdh15 A T 10: 74,645,973 probably null Het
Pramef20 T C 4: 144,377,777 R53G possibly damaging Het
Ptpn1 T C 2: 167,967,796 V108A possibly damaging Het
Rad9b T C 5: 122,339,768 N182D possibly damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scn2a G A 2: 65,743,104 V1433I probably benign Het
Ssrp1 T G 2: 85,045,339 probably benign Het
Suco T A 1: 161,835,183 K560* probably null Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem30c T C 16: 57,277,737 Y107C probably damaging Het
Topbp1 T A 9: 103,311,764 probably null Het
Trpm5 A T 7: 143,088,951 D86E probably damaging Het
Urb2 C T 8: 124,028,561 Q336* probably null Het
Vmn2r43 A G 7: 8,244,971 F731S probably damaging Het
Xkr9 A G 1: 13,684,135 T118A probably benign Het
Zcchc2 A C 1: 106,019,879 K117N probably damaging Het
Zfp52 T C 17: 21,560,471 Y194H probably damaging Het
Zfp763 C T 17: 33,018,701 C490Y possibly damaging Het
Zmynd19 G T 2: 24,958,119 R148L possibly damaging Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAGGAGTTGTTGACAGAGC -3'
(R):5'- TCTGCAGTGTTCTATGCCAATC -3'

Sequencing Primer
(F):5'- TTGACAGAGCTGGACTTGGCC -3'
(R):5'- TCTATGCCAATCTCCGCGGG -3'
Posted On2017-10-10