Incidental Mutation 'R6165:Trim35'
ID490110
Institutional Source Beutler Lab
Gene Symbol Trim35
Ensembl Gene ENSMUSG00000022043
Gene Nametripartite motif-containing 35
SynonymsHls5, Mair, A430106H13Rik, 0710005M05Rik
MMRRC Submission 044311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6165 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location66297031-66311424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66309205 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 474 (Y474H)
Ref Sequence ENSEMBL: ENSMUSP00000022623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022623]
Predicted Effect probably damaging
Transcript: ENSMUST00000022623
AA Change: Y474H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022623
Gene: ENSMUSG00000022043
AA Change: Y474H

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 29 N/A INTRINSIC
RING 36 75 6.89e-8 SMART
BBOX 111 152 1.27e-6 SMART
coiled coil region 219 267 N/A INTRINSIC
PRY 316 367 4.41e-15 SMART
Pfam:SPRY 370 495 3.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121006
SMART Domains Protein: ENSMUSP00000112877
Gene: ENSMUSG00000022043

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
RING 30 69 6.89e-8 SMART
BBOX 105 146 1.27e-6 SMART
coiled coil region 212 260 N/A INTRINSIC
low complexity region 330 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,683,307 E303G possibly damaging Het
C2cd5 T C 6: 143,050,228 T389A possibly damaging Het
Catsperb T A 12: 101,575,816 Y592N possibly damaging Het
Cnot9 T C 1: 74,528,793 V280A probably benign Het
Cyld A G 8: 88,746,933 I927V possibly damaging Het
Etfdh A T 3: 79,604,944 S490T probably benign Het
Fam214a A G 9: 75,025,672 T974A probably damaging Het
Fance C T 17: 28,326,094 R150C probably benign Het
Far1 A G 7: 113,554,218 K353E probably benign Het
Fbn1 T C 2: 125,332,363 I1858V probably damaging Het
Frem1 T C 4: 82,956,255 K1359E probably benign Het
Ghdc T G 11: 100,769,102 E273A possibly damaging Het
Gpt A G 15: 76,697,970 D209G probably benign Het
H2afy A T 13: 56,104,455 N108K probably damaging Het
Hspb7 T C 4: 141,422,551 F83L probably benign Het
Itga7 A G 10: 128,942,935 I306M probably benign Het
Itgb5 A G 16: 33,899,242 E261G probably benign Het
Kcnj14 G T 7: 45,820,000 A27E possibly damaging Het
Kif13b A G 14: 64,742,311 H470R probably damaging Het
Maats1 A G 16: 38,333,811 F124S possibly damaging Het
Morc3 T C 16: 93,841,383 F18L probably damaging Het
Mrgprb8 T A 7: 48,388,817 C79S possibly damaging Het
Mroh2b T A 15: 4,918,350 M549K probably benign Het
Msl1 T C 11: 98,804,847 V563A probably damaging Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr1489 A T 19: 13,633,143 I11F possibly damaging Het
Olfr1489 C T 19: 13,633,588 A159V probably benign Het
Phf2 C A 13: 48,813,865 probably null Het
Pjvk T G 2: 76,650,218 probably null Het
Rgl2 A G 17: 33,931,765 T66A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtkn G T 6: 83,145,963 E67D probably damaging Het
Serpinb9 T A 13: 33,008,824 F121L possibly damaging Het
Slc17a2 G A 13: 23,815,070 V149I probably benign Het
Sobp A G 10: 43,022,603 S329P probably damaging Het
Syne1 A T 10: 5,425,678 L138Q probably damaging Het
Tfr2 T A 5: 137,580,257 V449D probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Trank1 T C 9: 111,391,872 V2559A probably benign Het
Uso1 A T 5: 92,187,267 L495F probably damaging Het
Wdr24 A G 17: 25,826,421 I377V probably benign Het
Xpo5 T A 17: 46,235,957 V878D possibly damaging Het
Zfc3h1 A G 10: 115,420,669 I1515V probably benign Het
Zfp319 CA C 8: 95,328,105 probably null Het
Zfp384 T G 6: 125,024,933 probably null Het
Zfp704 G T 3: 9,443,886 P416T probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Trim35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Trim35 APN 14 66308801 missense probably damaging 1.00
IGL02398:Trim35 APN 14 66309248 missense probably damaging 1.00
IGL03132:Trim35 APN 14 66309146 missense probably damaging 1.00
R0759:Trim35 UTSW 14 66308787 missense probably benign 0.02
R0799:Trim35 UTSW 14 66309201 missense probably damaging 1.00
R0848:Trim35 UTSW 14 66309125 missense probably benign 0.01
R1170:Trim35 UTSW 14 66308799 missense probably benign 0.35
R1734:Trim35 UTSW 14 66309329 missense probably damaging 0.99
R1751:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R1767:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R2259:Trim35 UTSW 14 66309262 nonsense probably null
R3963:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R4572:Trim35 UTSW 14 66307873 missense probably damaging 1.00
R5068:Trim35 UTSW 14 66308972 unclassified probably benign
R5069:Trim35 UTSW 14 66308972 unclassified probably benign
R5070:Trim35 UTSW 14 66308972 unclassified probably benign
R5372:Trim35 UTSW 14 66297266 missense possibly damaging 0.69
R5886:Trim35 UTSW 14 66304053 missense possibly damaging 0.92
R5886:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R6018:Trim35 UTSW 14 66308750 missense probably damaging 1.00
R6326:Trim35 UTSW 14 66303204 missense possibly damaging 0.52
R6476:Trim35 UTSW 14 66308795 missense probably damaging 1.00
R7084:Trim35 UTSW 14 66308822 missense probably damaging 0.98
R7192:Trim35 UTSW 14 66297446 missense probably damaging 1.00
R7350:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R7546:Trim35 UTSW 14 66303247 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGCTACCATGATACACGCTC -3'
(R):5'- CTGGGTGGCTCCTAACTTTG -3'

Sequencing Primer
(F):5'- ATGATACACGCTCAGGCTTCTGG -3'
(R):5'- GGCTCCTAACTTTGGAGCTACAG -3'
Posted On2017-10-10