Incidental Mutation 'R6168:Fbrsl1'
ID490243
Institutional Source Beutler Lab
Gene Symbol Fbrsl1
Ensembl Gene ENSMUSG00000043323
Gene Namefibrosin-like 1
Synonyms2410025L10Rik, LOC381668
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6168 (G1)
Quality Score163.009
Status Not validated
Chromosome5
Chromosomal Location110361754-110448503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110396056 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 54 (V54M)
Ref Sequence ENSEMBL: ENSMUSP00000142379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069483] [ENSMUST00000196801] [ENSMUST00000198768]
Predicted Effect probably benign
Transcript: ENSMUST00000069483
AA Change: V217M

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000063879
Gene: ENSMUSG00000043323
AA Change: V217M

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 476 493 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Pfam:Auts2 564 767 1.9e-95 PFAM
low complexity region 902 918 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
low complexity region 966 980 N/A INTRINSIC
low complexity region 981 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196801
AA Change: V217M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142625
Gene: ENSMUSG00000043323
AA Change: V217M

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 447 456 N/A INTRINSIC
low complexity region 489 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198768
AA Change: V54M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142379
Gene: ENSMUSG00000043323
AA Change: V54M

DomainStartEndE-ValueType
low complexity region 17 38 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Fbrsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fbrsl1 APN 5 110378248 missense probably damaging 0.99
IGL01743:Fbrsl1 APN 5 110381640 missense probably damaging 0.98
IGL01910:Fbrsl1 APN 5 110363736 missense probably damaging 1.00
F5770:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
FR4342:Fbrsl1 UTSW 5 110378125 small insertion probably benign
FR4589:Fbrsl1 UTSW 5 110378150 small insertion probably benign
R0084:Fbrsl1 UTSW 5 110379515 missense probably damaging 0.99
R0126:Fbrsl1 UTSW 5 110396040 splice site probably benign
R0336:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R1196:Fbrsl1 UTSW 5 110374519 missense probably benign 0.21
R1712:Fbrsl1 UTSW 5 110447996 missense probably benign 0.01
R1998:Fbrsl1 UTSW 5 110376439 missense probably benign 0.43
R2081:Fbrsl1 UTSW 5 110371625 critical splice acceptor site probably null
R2108:Fbrsl1 UTSW 5 110378434 missense probably damaging 0.97
R4420:Fbrsl1 UTSW 5 110378986 missense possibly damaging 0.66
R4472:Fbrsl1 UTSW 5 110379066 start gained probably benign
R4931:Fbrsl1 UTSW 5 110379029 missense possibly damaging 0.89
R4994:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R5025:Fbrsl1 UTSW 5 110417901 missense probably damaging 0.99
R5084:Fbrsl1 UTSW 5 110379406 start gained probably benign
R5326:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5542:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5590:Fbrsl1 UTSW 5 110381618 missense probably damaging 0.96
R6234:Fbrsl1 UTSW 5 110378051 missense probably damaging 0.97
R6325:Fbrsl1 UTSW 5 110377407 missense probably damaging 1.00
R6661:Fbrsl1 UTSW 5 110378097 missense probably damaging 1.00
R7269:Fbrsl1 UTSW 5 110433014 missense probably benign 0.15
V7582:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0018:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0019:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0020:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0021:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0022:Fbrsl1 UTSW 5 110371549 missense probably damaging 1.00
X0022:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0023:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0024:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0027:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0050:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0052:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0053:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0054:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0057:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0058:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0060:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0061:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0062:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0063:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0064:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0065:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0066:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0067:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGTCCGAGGTCTACTGTTG -3'
(R):5'- AGTCCACCTATCCTGAGGGAAG -3'

Sequencing Primer
(F):5'- TGCCTAACTGATATCATGGCAGGC -3'
(R):5'- GGAAGCTAGCCGTATTATGCC -3'
Posted On2017-10-10