Incidental Mutation 'R6229:Fis1'
ID504546
Institutional Source Beutler Lab
Gene Symbol Fis1
Ensembl Gene ENSMUSG00000019054
Gene Namefission, mitochondrial 1
SynonymsTtc11
MMRRC Submission 044358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6229 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136953275-136966234 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 136965674 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001790] [ENSMUST00000019198] [ENSMUST00000111093] [ENSMUST00000111094] [ENSMUST00000111097]
Predicted Effect probably benign
Transcript: ENSMUST00000001790
SMART Domains Protein: ENSMUSP00000001790
Gene: ENSMUSG00000001739

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019198
SMART Domains Protein: ENSMUSP00000019198
Gene: ENSMUSG00000019054

DomainStartEndE-ValueType
Pfam:Fis1_TPR_N 33 65 2.3e-18 PFAM
Pfam:Fis1_TPR_C 71 123 2.1e-27 PFAM
low complexity region 124 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111093
SMART Domains Protein: ENSMUSP00000106722
Gene: ENSMUSG00000001739

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.5e-36 PFAM
Pfam:Claudin_2 12 181 2.2e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111094
SMART Domains Protein: ENSMUSP00000106723
Gene: ENSMUSG00000019054

DomainStartEndE-ValueType
Pfam:Fis1_TPR_N 25 59 3.1e-20 PFAM
Pfam:Fis1_TPR_C 64 116 6.1e-28 PFAM
low complexity region 117 140 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111097
SMART Domains Protein: ENSMUSP00000106726
Gene: ENSMUSG00000019054

DomainStartEndE-ValueType
Pfam:Fis1_TPR_C 21 73 1.4e-28 PFAM
low complexity region 74 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152658
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G A 1: 120,171,483 probably null Het
Adamts6 G A 13: 104,347,392 probably null Het
Add3 C A 19: 53,234,846 A343D probably benign Het
Ankub1 T C 3: 57,665,107 D398G probably benign Het
Apbb1 C T 7: 105,573,730 A225T probably damaging Het
Apbb1 C A 7: 105,573,731 W224C probably damaging Het
Arhgef40 A T 14: 51,990,090 Q431L probably benign Het
Calm4 A G 13: 3,838,038 D48G possibly damaging Het
Ccdc18 A T 5: 108,171,618 I502L probably benign Het
Cftr T C 6: 18,220,684 S185P probably damaging Het
Chd2 C A 7: 73,451,723 K1418N possibly damaging Het
Cmya5 A C 13: 93,093,306 V1758G probably benign Het
Cpsf4l T C 11: 113,708,854 K35R possibly damaging Het
Cyp2c68 A T 19: 39,739,178 V119E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah3 G T 7: 119,965,488 Q2651K probably benign Het
Eif4g2 T C 7: 111,077,713 probably null Het
Enc1 A G 13: 97,245,491 R170G probably benign Het
Enpp2 T C 15: 54,877,832 R357G probably damaging Het
Epb41l2 A G 10: 25,499,836 K58E possibly damaging Het
Fmo9 A C 1: 166,677,557 M89R possibly damaging Het
Gm13119 T C 4: 144,363,629 M413T probably benign Het
Gm6096 A C 7: 34,251,251 I72L possibly damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Got1l1 T C 8: 27,198,436 probably null Het
Igfbpl1 A G 4: 45,813,517 Y233H probably damaging Het
Il18r1 T C 1: 40,474,763 I43T probably benign Het
Ints8 T C 4: 11,252,891 N64D probably damaging Het
Kalrn A G 16: 34,055,071 S44P probably damaging Het
Kif13b G T 14: 64,738,567 G444W probably damaging Het
Lmo1 A G 7: 109,143,625 C13R probably damaging Het
Lrfn2 T A 17: 49,097,132 M761K possibly damaging Het
Lrrd1 T C 5: 3,863,887 I719T probably damaging Het
Madd A T 2: 91,143,670 V1423E probably damaging Het
Mbnl1 T A 3: 60,621,328 probably null Het
Mrps28 T C 3: 8,900,037 D114G probably damaging Het
Muc6 T A 7: 141,640,525 M1412L probably benign Het
Myf6 T C 10: 107,494,419 K96E possibly damaging Het
Myrf A G 19: 10,219,798 V462A probably benign Het
Nbeal1 T C 1: 60,248,365 S923P possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nfatc2ip C T 7: 126,395,941 probably null Het
Olfr1145 G T 2: 87,810,087 C89F probably damaging Het
Olfr1362 T C 13: 21,611,649 I107V probably benign Het
Olfr739 A G 14: 50,425,205 R229G probably benign Het
Olfr853 T A 9: 19,537,718 I71F possibly damaging Het
Plin2 A G 4: 86,668,666 V5A probably benign Het
Ptprm T A 17: 66,688,300 D1311V probably damaging Het
Recql5 A T 11: 115,930,714 I72N probably damaging Het
Sall2 A T 14: 52,313,191 M847K probably benign Het
Slc23a1 T C 18: 35,619,524 R567G probably benign Het
Slc28a1 G A 7: 81,125,005 R200H probably benign Het
Smc4 T A 3: 69,030,247 Y843* probably null Het
Syne2 C A 12: 75,921,220 Q915K probably benign Het
Tas2r131 T A 6: 132,957,022 I275F probably damaging Het
Tcf20 T C 15: 82,854,880 H790R probably damaging Het
Tm7sf3 A G 6: 146,613,389 F310S possibly damaging Het
Tmem9b T A 7: 109,745,420 probably null Het
Tnfaip8 A G 18: 50,051,675 probably benign Het
Top2b T G 14: 16,409,838 L835R probably damaging Het
Trappc8 A T 18: 20,870,745 S209T probably benign Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Uap1 C T 1: 170,166,733 R58Q probably benign Het
Upk3bl A G 5: 136,064,061 probably null Het
Usp34 A G 11: 23,446,778 H596R probably damaging Het
Vmn1r181 C T 7: 23,984,155 A15V probably damaging Het
Vmn2r54 T A 7: 12,631,956 K350N probably benign Het
Vmn2r89 A G 14: 51,455,721 H176R probably benign Het
Vwa7 A G 17: 35,024,265 R640G probably benign Het
Other mutations in Fis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Fis1 APN 5 136965974 missense probably benign 0.38
R0650:Fis1 UTSW 5 136962194 missense probably damaging 0.98
R1077:Fis1 UTSW 5 136965146 missense probably damaging 1.00
R1920:Fis1 UTSW 5 136965607 missense probably benign 0.07
R2848:Fis1 UTSW 5 136963117 missense possibly damaging 0.91
R2849:Fis1 UTSW 5 136963117 missense possibly damaging 0.91
R4678:Fis1 UTSW 5 136963097 missense possibly damaging 0.67
R5410:Fis1 UTSW 5 136965566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTGTTTGTGAACTCTACTC -3'
(R):5'- CATGCCTACCAGTCCATCTG -3'

Sequencing Primer
(F):5'- AACTCTACTCTGTGGGGTGG -3'
(R):5'- AGGTGTGAGCAGACCAGTCC -3'
Posted On2018-02-28