Incidental Mutation 'R6293:Prex2'
ID508527
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
SynonymsC030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10993465-11303681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11162298 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 863 (N863S)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
Predicted Effect probably benign
Transcript: ENSMUST00000027056
AA Change: N863S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: N863S

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187694
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11186652 missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11170614 missense probably damaging 0.98
IGL01087:Prex2 APN 1 11068104 missense probably benign 0.00
IGL01490:Prex2 APN 1 11184545 splice site probably null
IGL01533:Prex2 APN 1 11186741 nonsense probably null
IGL01661:Prex2 APN 1 11208614 missense probably benign 0.01
IGL01668:Prex2 APN 1 11153645 missense probably benign 0.00
IGL01674:Prex2 APN 1 11170741 missense probably damaging 1.00
IGL01716:Prex2 APN 1 11266054 missense probably benign 0.04
IGL01867:Prex2 APN 1 11098503 missense probably benign 0.11
IGL01954:Prex2 APN 1 11140011 missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11123233 splice site probably benign
IGL02022:Prex2 APN 1 11297739 missense probably benign 0.04
IGL02130:Prex2 APN 1 11112799 missense probably damaging 1.00
IGL02130:Prex2 APN 1 11160162 missense probably damaging 1.00
IGL02221:Prex2 APN 1 11061345 missense probably benign 0.00
IGL02369:Prex2 APN 1 11101169 critical splice donor site probably null
IGL02440:Prex2 APN 1 11153657 missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11204154 missense probably benign
IGL02492:Prex2 APN 1 11123845 missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11142665 missense probably damaging 1.00
IGL03154:Prex2 APN 1 11153633 missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11266067 missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11185175 missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11140265 missense probably benign 0.01
R0042:Prex2 UTSW 1 11080081 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0138:Prex2 UTSW 1 11285043 splice site probably benign
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0208:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0325:Prex2 UTSW 1 11200057 splice site probably null
R0326:Prex2 UTSW 1 11285065 missense probably damaging 1.00
R0390:Prex2 UTSW 1 11089706 splice site probably null
R0492:Prex2 UTSW 1 11186633 splice site probably benign
R0512:Prex2 UTSW 1 11199933 missense probably benign
R0515:Prex2 UTSW 1 11199874 missense probably damaging 0.99
R0894:Prex2 UTSW 1 11181898 missense probably benign
R1259:Prex2 UTSW 1 11289270 missense probably damaging 1.00
R1332:Prex2 UTSW 1 11204091 missense probably damaging 1.00
R1356:Prex2 UTSW 1 11080092 nonsense probably null
R1451:Prex2 UTSW 1 11156259 missense probably benign 0.01
R1488:Prex2 UTSW 1 11193528 missense probably benign 0.05
R1512:Prex2 UTSW 1 11061330 missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11231772 missense probably damaging 0.99
R1667:Prex2 UTSW 1 11186757 missense probably benign
R1678:Prex2 UTSW 1 11285089 missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11089884 splice site probably benign
R1781:Prex2 UTSW 1 11199955 missense probably benign 0.17
R1804:Prex2 UTSW 1 11132342 missense probably damaging 1.00
R1836:Prex2 UTSW 1 11136780 missense probably damaging 1.00
R1899:Prex2 UTSW 1 11162366 nonsense probably null
R1900:Prex2 UTSW 1 11162366 nonsense probably null
R2020:Prex2 UTSW 1 11162312 missense probably damaging 0.98
R2114:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2117:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2436:Prex2 UTSW 1 11266152 missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11208614 missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11169853 missense probably damaging 1.00
R2924:Prex2 UTSW 1 11098487 missense probably damaging 1.00
R2981:Prex2 UTSW 1 11181962 missense probably damaging 1.00
R3430:Prex2 UTSW 1 11149854 missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11156364 splice site probably benign
R3870:Prex2 UTSW 1 11160192 missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11110357 missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11184516 missense probably benign
R4030:Prex2 UTSW 1 11208568 missense probably benign 0.06
R4214:Prex2 UTSW 1 11101159 missense probably damaging 1.00
R4214:Prex2 UTSW 1 11285061 missense probably damaging 1.00
R4242:Prex2 UTSW 1 11156304 missense probably benign 0.06
R4490:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4491:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4492:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4561:Prex2 UTSW 1 11184545 splice site probably null
R4624:Prex2 UTSW 1 11289265 nonsense probably null
R4647:Prex2 UTSW 1 11162285 missense probably damaging 1.00
R4657:Prex2 UTSW 1 11065825 missense probably benign 0.00
R4706:Prex2 UTSW 1 11199988 missense probably damaging 1.00
R4806:Prex2 UTSW 1 11068020 missense probably damaging 1.00
R4900:Prex2 UTSW 1 11149905 splice site probably benign
R4922:Prex2 UTSW 1 11169940 missense probably damaging 1.00
R4961:Prex2 UTSW 1 11098481 missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11266090 nonsense probably null
R5305:Prex2 UTSW 1 11107678 missense probably damaging 1.00
R5307:Prex2 UTSW 1 11200032 missense probably damaging 0.99
R5331:Prex2 UTSW 1 11140011 missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11139980 missense probably damaging 0.99
R5574:Prex2 UTSW 1 11140058 missense probably damaging 1.00
R5979:Prex2 UTSW 1 11132372 missense probably damaging 1.00
R6076:Prex2 UTSW 1 11185950 missense probably benign 0.09
R6160:Prex2 UTSW 1 10993851 missense probably damaging 1.00
R6177:Prex2 UTSW 1 11136777 missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11266012 missense probably benign 0.01
R6335:Prex2 UTSW 1 11110320 missense probably benign 0.13
R6401:Prex2 UTSW 1 11186727 missense probably benign 0.00
R6427:Prex2 UTSW 1 11182031 missense probably damaging 1.00
R6467:Prex2 UTSW 1 11266035 missense probably damaging 1.00
R6564:Prex2 UTSW 1 11101061 splice site probably null
R6734:Prex2 UTSW 1 11080059 missense probably damaging 1.00
R6753:Prex2 UTSW 1 11184456 missense probably damaging 0.98
R6880:Prex2 UTSW 1 11132384 missense probably damaging 1.00
R6973:Prex2 UTSW 1 11112743 missense probably damaging 1.00
R6980:Prex2 UTSW 1 11162263 missense probably benign 0.05
R6987:Prex2 UTSW 1 11170752 missense probably damaging 0.99
R7085:Prex2 UTSW 1 11098588 missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11153609 missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11136793 missense probably benign 0.33
R7319:Prex2 UTSW 1 11162308 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGAAGTCAGTTTATAGGCTCATGG -3'
(R):5'- ACCCCTACTTAGCCTCAAGG -3'

Sequencing Primer
(F):5'- GCTCATGGAACTAAACCTGGGC -3'
(R):5'- GCCTCAAGGATTTTCTTATAGCAAC -3'
Posted On2018-03-15