Incidental Mutation 'R6312:Olfr883'
ID509826
Institutional Source Beutler Lab
Gene Symbol Olfr883
Ensembl Gene ENSMUSG00000094461
Gene Nameolfactory receptor 883
SynonymsGA_x6K02T2PVTD-31705144-31706073, MOR162-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6312 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location38025808-38026737 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTTT to GTTTGCTGTTTT at 38026546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072974]
Predicted Effect probably null
Transcript: ENSMUST00000072974
SMART Domains Protein: ENSMUSP00000072741
Gene: ENSMUSG00000094461

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-48 PFAM
Pfam:7tm_1 41 288 3.7e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
Bmper C A 9: 23,406,791 Q569K possibly damaging Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Olfr883
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Olfr883 APN 9 38025811 missense probably benign 0.02
IGL02092:Olfr883 APN 9 38026621 missense possibly damaging 0.80
IGL02351:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02358:Olfr883 APN 9 38026036 missense possibly damaging 0.78
IGL02807:Olfr883 APN 9 38026189 missense probably damaging 1.00
R0972:Olfr883 UTSW 9 38026560 missense possibly damaging 0.88
R1016:Olfr883 UTSW 9 38026691 missense probably damaging 0.98
R1818:Olfr883 UTSW 9 38026507 missense probably damaging 1.00
R4466:Olfr883 UTSW 9 38026183 missense probably damaging 0.99
R4871:Olfr883 UTSW 9 38026526 missense probably damaging 1.00
R5977:Olfr883 UTSW 9 38026540 frame shift probably null
R5979:Olfr883 UTSW 9 38026540 frame shift probably null
R6026:Olfr883 UTSW 9 38026540 frame shift probably null
R6027:Olfr883 UTSW 9 38026540 frame shift probably null
R6029:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6035:Olfr883 UTSW 9 38026540 frame shift probably null
R6053:Olfr883 UTSW 9 38026541 frame shift probably null
R6092:Olfr883 UTSW 9 38026540 frame shift probably null
R6106:Olfr883 UTSW 9 38026466 missense probably damaging 1.00
R6131:Olfr883 UTSW 9 38026540 frame shift probably null
R6132:Olfr883 UTSW 9 38026540 frame shift probably null
R6133:Olfr883 UTSW 9 38026540 frame shift probably null
R6134:Olfr883 UTSW 9 38026540 frame shift probably null
R6153:Olfr883 UTSW 9 38026540 frame shift probably null
R6251:Olfr883 UTSW 9 38026537 frame shift probably null
R6251:Olfr883 UTSW 9 38026545 frame shift probably null
R6251:Olfr883 UTSW 9 38026546 frame shift probably null
R6251:Olfr883 UTSW 9 38026548 frame shift probably null
R6300:Olfr883 UTSW 9 38026540 frame shift probably null
R6301:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026540 frame shift probably null
R6305:Olfr883 UTSW 9 38026542 frame shift probably null
R6307:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026540 frame shift probably null
R6312:Olfr883 UTSW 9 38026541 frame shift probably null
R6312:Olfr883 UTSW 9 38026547 nonsense probably null
R6312:Olfr883 UTSW 9 38026549 frame shift probably null
R6813:Olfr883 UTSW 9 38025833 missense probably damaging 1.00
R7134:Olfr883 UTSW 9 38026499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACCACCATCAATGAGTTG -3'
(R):5'- ATCCTATGTCAGTTACCTACTACAC -3'

Sequencing Primer
(F):5'- CAATGAGTTGGTGGTTTTCATTG -3'
(R):5'- CCTCAGAAGCCATAAGATTTTAGTTC -3'
Posted On2018-04-02