Incidental Mutation 'R6373:Twnk'
ID513651
Institutional Source Beutler Lab
Gene Symbol Twnk
Ensembl Gene ENSMUSG00000025209
Gene Nametwinkle mtDNA helicase
Synonymstwinkle, Twinl, Peo1, D19Ertd626e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6373 (G1)
Quality Score224.009
Status Validated
Chromosome19
Chromosomal Location45006558-45012762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45009381 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 450 (V450M)
Ref Sequence ENSEMBL: ENSMUSP00000026227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026227] [ENSMUST00000097715]
Predicted Effect probably damaging
Transcript: ENSMUST00000026227
AA Change: V450M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026227
Gene: ENSMUSG00000025209
AA Change: V450M

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
Blast:TOPRIM 260 331 8e-16 BLAST
Pfam:AAA_25 377 565 5.6e-25 PFAM
Pfam:DnaB_C 390 631 6.7e-17 PFAM
Pfam:KaiC 394 628 2.6e-11 PFAM
low complexity region 650 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097715
SMART Domains Protein: ENSMUSP00000095322
Gene: ENSMUSG00000025208

DomainStartEndE-ValueType
L51_S25_CI-B8 35 108 1.61e-23 SMART
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The protein localizes to the mitochondrial matrix and mitochondrial nucleoids. Mutations in this gene cause infantile onset spinocerebellar ataxia (IOSCA) and progressive external ophthalmoplegia (PEO) and are also associated with several mitochondrial depletion syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous embryos display abnormal development. Embryos die around E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,988,240 L279P probably damaging Het
Aldh16a1 C G 7: 45,146,271 V373L probably benign Het
Btn2a2 T C 13: 23,481,829 K278E probably benign Het
Carns1 G T 19: 4,166,516 Q556K probably benign Het
Chd1 A T 17: 15,738,636 E650V probably damaging Het
Cobl A G 11: 12,253,118 S1195P probably damaging Het
Ddx58 A G 4: 40,216,487 Y504H possibly damaging Het
Deup1 T C 9: 15,561,342 H464R probably damaging Het
Eva1a T C 6: 82,091,866 L58S probably damaging Het
Fign A C 2: 63,979,645 M427R probably benign Het
Gm6309 A T 5: 146,170,275 I87N probably damaging Het
Gm7879 A G 5: 43,913,551 T127A probably damaging Het
Helz A G 11: 107,595,184 T140A probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hist1h2ad A G 13: 23,574,853 K128R probably benign Het
Kif16b A T 2: 142,699,698 H1227Q possibly damaging Het
Mab21l1 A T 3: 55,783,084 I31F possibly damaging Het
Mex3c T C 18: 73,589,994 M386T probably benign Het
Myh11 T A 16: 14,205,130 I1644F possibly damaging Het
Nav2 C T 7: 49,453,175 P513S probably damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nmt2 A G 2: 3,324,951 T462A probably benign Het
Nrxn2 T C 19: 6,509,830 I163T probably damaging Het
Nrxn3 G C 12: 89,976,469 G122R probably damaging Het
Olfr1165-ps T C 2: 88,101,845 I47M possibly damaging Het
Olfr385 A G 11: 73,588,898 V280A probably benign Het
Parg T G 14: 32,209,497 probably null Het
Pcdhb7 T A 18: 37,342,211 C133* probably null Het
Rpe T C 1: 66,715,980 F174L probably benign Het
Rxrb A G 17: 34,033,559 N40S probably benign Het
Ryr3 C A 2: 112,656,544 G3840W probably damaging Het
Smurf2 A G 11: 106,833,769 L529P probably damaging Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spink5 A G 18: 43,990,672 E342G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syce1l T A 8: 113,649,511 M31K probably benign Het
Ttn C T 2: 76,788,616 V14394I probably damaging Het
Vangl1 T C 3: 102,158,448 K407R probably benign Het
Vmn1r19 T C 6: 57,405,332 I290T unknown Het
Other mutations in Twnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Twnk APN 19 45007626 missense probably benign 0.03
IGL01367:Twnk APN 19 45011651 missense possibly damaging 0.92
IGL01736:Twnk APN 19 45010188 missense probably damaging 0.97
IGL02724:Twnk APN 19 45008118 missense probably damaging 0.99
IGL03368:Twnk APN 19 45010492 missense probably damaging 0.99
R0121:Twnk UTSW 19 45009265 unclassified probably benign
R0389:Twnk UTSW 19 45008139 missense possibly damaging 0.67
R0427:Twnk UTSW 19 45007587 missense probably benign 0.00
R0443:Twnk UTSW 19 45008139 missense possibly damaging 0.67
R0501:Twnk UTSW 19 45007746 missense probably damaging 1.00
R0791:Twnk UTSW 19 45010254 unclassified probably benign
R1193:Twnk UTSW 19 45007790 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1487:Twnk UTSW 19 45008376 critical splice donor site probably null
R1556:Twnk UTSW 19 45009411 missense possibly damaging 0.80
R3895:Twnk UTSW 19 45007451 missense probably damaging 0.98
R5652:Twnk UTSW 19 45007293 missense possibly damaging 0.85
R6595:Twnk UTSW 19 45010492 missense probably damaging 0.99
R6880:Twnk UTSW 19 45007416 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAATTGAATTCAGGACCTCTG -3'
(R):5'- TAACAAGATCTGACGCCCTCTTC -3'

Sequencing Primer
(F):5'- AGCATGCTTAACTGCTGAGC -3'
(R):5'- TCTGAAGACAGCTACAGTGTAC -3'
Posted On2018-04-27