Incidental Mutation 'R6394:Jrkl'
ID515951
Institutional Source Beutler Lab
Gene Symbol Jrkl
Ensembl Gene ENSMUSG00000079083
Gene NameJrk-like
SynonymsC030035D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location13242607-13245829 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 13245490 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 55 (Y55*)
Ref Sequence ENSEMBL: ENSMUSP00000128798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110582] [ENSMUST00000110583] [ENSMUST00000217444]
Predicted Effect probably null
Transcript: ENSMUST00000110582
AA Change: Y55*
SMART Domains Protein: ENSMUSP00000128798
Gene: ENSMUSG00000079083
AA Change: Y55*

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-18 PFAM
CENPB 73 139 1.45e-24 SMART
Pfam:DDE_1 206 385 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110583
SMART Domains Protein: ENSMUSP00000106212
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 1.8e-50 PFAM
low complexity region 218 231 N/A INTRINSIC
Pfam:DUF4211 273 432 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169961
SMART Domains Protein: ENSMUSP00000126058
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 2.2e-55 PFAM
low complexity region 218 231 N/A INTRINSIC
low complexity region 250 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215735
Predicted Effect probably benign
Transcript: ENSMUST00000217444
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene has not yet been defined, however, the encoded protein shares similarity with the human (41% identical) and mouse (34% identical) jerky gene products. This protein may act as a nuclear regulatory protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Jrkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1432:Jrkl UTSW 9 13245332 missense probably benign 0.15
R1914:Jrkl UTSW 9 13245604 missense possibly damaging 0.48
R1915:Jrkl UTSW 9 13245604 missense possibly damaging 0.48
R2079:Jrkl UTSW 9 13244859 missense probably damaging 1.00
R2155:Jrkl UTSW 9 13244908 nonsense probably null
R3714:Jrkl UTSW 9 13244231 missense possibly damaging 0.77
R3734:Jrkl UTSW 9 13245530 missense possibly damaging 0.95
R4394:Jrkl UTSW 9 13245141 nonsense probably null
R4486:Jrkl UTSW 9 13245371 missense probably benign 0.36
R5687:Jrkl UTSW 9 13244382 missense probably benign 0.07
R5724:Jrkl UTSW 9 13244886 missense possibly damaging 0.68
R7002:Jrkl UTSW 9 13245521 missense probably damaging 1.00
R7196:Jrkl UTSW 9 13244157 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGTTAAAATCACCATCCATTCCC -3'
(R):5'- AACAGGTCGAGTGTTCTTAAGG -3'

Sequencing Primer
(F):5'- TCACCATCCATTCCCAAAGCG -3'
(R):5'- GCTACAGAGTGAGTTCCAGATTCTC -3'
Posted On2018-05-04