Incidental Mutation 'R6420:Pik3r5'
ID 518157
Institutional Source Beutler Lab
Gene Symbol Pik3r5
Ensembl Gene ENSMUSG00000020901
Gene Name phosphoinositide-3-kinase regulatory subunit 5
Synonyms p101, Foap2
MMRRC Submission 044562-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R6420 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68322951-68388675 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 68366250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 42 (W42*)
Ref Sequence ENSEMBL: ENSMUSP00000021283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021283]
AlphaFold Q5SW28
Predicted Effect probably null
Transcript: ENSMUST00000021283
AA Change: W42*
SMART Domains Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: W42*

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 6 871 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155887
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,473,566 (GRCm39) I117N probably damaging Het
Abca15 A G 7: 119,996,351 (GRCm39) K1426E possibly damaging Het
Arhgef17 A G 7: 100,579,269 (GRCm39) S560P probably damaging Het
Asb13 G A 13: 3,693,574 (GRCm39) V111I probably damaging Het
Dhx16 A G 17: 36,193,906 (GRCm39) E367G possibly damaging Het
Epc2 T C 2: 49,341,912 (GRCm39) V32A probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Hdlbp T C 1: 93,358,726 (GRCm39) E275G probably damaging Het
Kdm7a T C 6: 39,142,102 (GRCm39) D392G probably damaging Het
Lgmn T A 12: 102,389,978 (GRCm39) R4* probably null Het
Lrrk2 C T 15: 91,696,549 (GRCm39) R2446C probably benign Het
Map3k10 A G 7: 27,362,709 (GRCm39) F459S probably damaging Het
Mup1 C G 4: 60,457,758 (GRCm39) E31Q possibly damaging Het
Nckap1l G C 15: 103,399,893 (GRCm39) G1025A possibly damaging Het
Or4d10 T G 19: 12,051,324 (GRCm39) K224T probably benign Het
Or5b24 A C 19: 12,912,584 (GRCm39) T161P probably damaging Het
Or8b39 T A 9: 37,996,890 (GRCm39) S253T probably benign Het
Or8b41 T G 9: 38,054,611 (GRCm39) L55R probably damaging Het
Or8k38 A T 2: 86,488,510 (GRCm39) C97* probably null Het
Pkd1l2 C T 8: 117,740,638 (GRCm39) C2153Y probably damaging Het
Rad1 T C 15: 10,488,098 (GRCm39) V74A probably benign Het
Scara3 C T 14: 66,175,701 (GRCm39) G22D possibly damaging Het
Scn1a A G 2: 66,103,542 (GRCm39) I1906T probably damaging Het
Sema5b T A 16: 35,483,516 (GRCm39) D1051E probably benign Het
Slc16a12 T C 19: 34,650,097 (GRCm39) probably null Het
Slc25a23 T C 17: 57,359,780 (GRCm39) I324V probably damaging Het
Sord A T 2: 122,094,602 (GRCm39) K330M possibly damaging Het
Spag9 T C 11: 93,977,128 (GRCm39) V78A probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Tnrc6a A G 7: 122,770,297 (GRCm39) T696A probably benign Het
Ttn A G 2: 76,542,619 (GRCm39) Y33456H possibly damaging Het
Unc45a C G 7: 79,989,400 (GRCm39) E23Q probably benign Het
Urb2 C T 8: 124,773,938 (GRCm39) R1490W probably damaging Het
Zfp62 A T 11: 49,107,340 (GRCm39) N477I probably damaging Het
Zfp846 T C 9: 20,505,007 (GRCm39) L289P probably damaging Het
Zfp959 G A 17: 56,205,094 (GRCm39) G377D probably damaging Het
Zswim3 G A 2: 164,662,653 (GRCm39) V378M probably damaging Het
Other mutations in Pik3r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Pik3r5 APN 11 68,387,020 (GRCm39) missense possibly damaging 0.68
IGL01400:Pik3r5 APN 11 68,385,373 (GRCm39) missense probably benign 0.01
IGL01597:Pik3r5 APN 11 68,386,827 (GRCm39) missense probably damaging 1.00
IGL01622:Pik3r5 APN 11 68,377,452 (GRCm39) splice site probably null
IGL01623:Pik3r5 APN 11 68,377,452 (GRCm39) splice site probably null
IGL01878:Pik3r5 APN 11 68,383,356 (GRCm39) missense probably benign 0.00
IGL01953:Pik3r5 APN 11 68,384,997 (GRCm39) missense probably benign 0.00
IGL02056:Pik3r5 APN 11 68,381,681 (GRCm39) missense possibly damaging 0.86
IGL02345:Pik3r5 APN 11 68,383,552 (GRCm39) missense probably benign 0.03
palmetto UTSW 11 68,385,059 (GRCm39) missense probably damaging 1.00
Palmito UTSW 11 68,382,826 (GRCm39) missense probably damaging 1.00
palms UTSW 11 68,377,448 (GRCm39) critical splice donor site probably null
piranha UTSW 11 68,377,407 (GRCm39) missense probably damaging 1.00
Serenoa_repens UTSW 11 68,366,250 (GRCm39) nonsense probably null
IGL02799:Pik3r5 UTSW 11 68,386,773 (GRCm39) missense probably damaging 0.98
R0077:Pik3r5 UTSW 11 68,377,448 (GRCm39) critical splice donor site probably null
R0092:Pik3r5 UTSW 11 68,383,629 (GRCm39) missense probably benign
R0105:Pik3r5 UTSW 11 68,381,337 (GRCm39) missense probably damaging 0.99
R0118:Pik3r5 UTSW 11 68,381,306 (GRCm39) missense probably damaging 1.00
R1204:Pik3r5 UTSW 11 68,385,050 (GRCm39) missense probably benign 0.03
R1447:Pik3r5 UTSW 11 68,385,003 (GRCm39) missense probably benign 0.18
R1865:Pik3r5 UTSW 11 68,383,318 (GRCm39) missense probably damaging 1.00
R2034:Pik3r5 UTSW 11 68,384,403 (GRCm39) missense probably damaging 0.99
R2356:Pik3r5 UTSW 11 68,383,743 (GRCm39) missense probably damaging 1.00
R4588:Pik3r5 UTSW 11 68,384,087 (GRCm39) intron probably benign
R4716:Pik3r5 UTSW 11 68,386,030 (GRCm39) missense possibly damaging 0.48
R4960:Pik3r5 UTSW 11 68,384,464 (GRCm39) missense probably benign 0.19
R5217:Pik3r5 UTSW 11 68,382,790 (GRCm39) missense possibly damaging 0.67
R5518:Pik3r5 UTSW 11 68,368,294 (GRCm39) missense possibly damaging 0.86
R5528:Pik3r5 UTSW 11 68,386,803 (GRCm39) missense probably damaging 1.00
R5554:Pik3r5 UTSW 11 68,385,059 (GRCm39) missense probably damaging 1.00
R5693:Pik3r5 UTSW 11 68,385,077 (GRCm39) missense probably damaging 1.00
R5841:Pik3r5 UTSW 11 68,383,096 (GRCm39) missense probably damaging 1.00
R6025:Pik3r5 UTSW 11 68,383,144 (GRCm39) missense probably damaging 0.97
R6168:Pik3r5 UTSW 11 68,383,501 (GRCm39) missense probably benign
R6243:Pik3r5 UTSW 11 68,382,826 (GRCm39) missense probably damaging 1.00
R6322:Pik3r5 UTSW 11 68,383,567 (GRCm39) missense probably benign
R6505:Pik3r5 UTSW 11 68,383,615 (GRCm39) missense probably benign 0.16
R6534:Pik3r5 UTSW 11 68,381,443 (GRCm39) missense possibly damaging 0.59
R6817:Pik3r5 UTSW 11 68,377,407 (GRCm39) missense probably damaging 1.00
R7246:Pik3r5 UTSW 11 68,383,769 (GRCm39) missense probably benign 0.01
R7459:Pik3r5 UTSW 11 68,383,416 (GRCm39) missense probably benign 0.03
R7527:Pik3r5 UTSW 11 68,367,177 (GRCm39) missense probably damaging 1.00
R7739:Pik3r5 UTSW 11 68,381,324 (GRCm39) missense probably damaging 1.00
R7817:Pik3r5 UTSW 11 68,384,483 (GRCm39) missense probably damaging 0.99
R7877:Pik3r5 UTSW 11 68,381,431 (GRCm39) missense probably damaging 1.00
R7885:Pik3r5 UTSW 11 68,383,528 (GRCm39) missense possibly damaging 0.57
R7960:Pik3r5 UTSW 11 68,386,796 (GRCm39) missense probably benign 0.22
R8816:Pik3r5 UTSW 11 68,385,060 (GRCm39) missense probably damaging 1.00
R8836:Pik3r5 UTSW 11 68,385,104 (GRCm39) missense probably benign 0.06
R9131:Pik3r5 UTSW 11 68,383,099 (GRCm39) missense possibly damaging 0.64
R9649:Pik3r5 UTSW 11 68,381,720 (GRCm39) missense probably benign 0.00
R9706:Pik3r5 UTSW 11 68,381,426 (GRCm39) missense probably benign 0.00
Z1177:Pik3r5 UTSW 11 68,383,722 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGATGCCATTTCTCCAAGACTC -3'
(R):5'- CTATGAACTCAGGTCCACACGG -3'

Sequencing Primer
(F):5'- GCCATTTCTCCAAGACTCTATTTAG -3'
(R):5'- ACAGGATAGGACATTCCATGC -3'
Posted On 2018-05-24