Incidental Mutation 'R6426:Zswim8'
ID518332
Institutional Source Beutler Lab
Gene Symbol Zswim8
Ensembl Gene ENSMUSG00000021819
Gene Namezinc finger SWIM-type containing 8
Synonyms2310021P13Rik, 4832404P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6426 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20707552-20723619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20718526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1035 (S1035T)
Ref Sequence ENSEMBL: ENSMUSP00000153285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224751]
Predicted Effect probably damaging
Transcript: ENSMUST00000022358
AA Change: S1042T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: S1042T

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably damaging
Transcript: ENSMUST00000223840
AA Change: S1008T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224485
Predicted Effect probably damaging
Transcript: ENSMUST00000224751
AA Change: S1035T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225743
Predicted Effect probably benign
Transcript: ENSMUST00000225911
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Adcyap1r1 T G 6: 55,494,187 L365R probably damaging Het
Adgre4 A G 17: 55,802,196 N401S probably benign Het
Adgrl3 A T 5: 81,726,870 S1073C probably damaging Het
Bicral G A 17: 46,830,079 P26S probably benign Het
Cst3 G T 2: 148,871,997 T129K probably benign Het
Cyp26a1 T C 19: 37,699,305 M287T probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dmxl1 T C 18: 49,864,578 V611A probably damaging Het
Fam149a C A 8: 45,381,574 A63S probably benign Het
Fam160b1 T G 19: 57,383,178 L574R probably damaging Het
Foxred2 C G 15: 77,953,308 A243P probably damaging Het
Gm3604 A T 13: 62,369,622 D307E probably damaging Het
Lca5 G A 9: 83,395,654 Q546* probably null Het
Mfsd4b1 T C 10: 40,006,077 T71A possibly damaging Het
Olfr76 A G 19: 12,119,848 V288A probably benign Het
Onecut1 A G 9: 74,862,349 H18R probably damaging Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Pcsk5 G T 19: 17,617,729 Q414K probably damaging Het
Ppp4r2 T C 6: 100,852,597 Y77H probably damaging Het
Prr19 A G 7: 25,303,837 D292G probably damaging Het
Pum1 G A 4: 130,753,972 R464H probably damaging Het
Rhoq G T 17: 86,995,014 R126L probably damaging Het
Sdhb A G 4: 140,973,718 K162E probably benign Het
Sema3d G A 5: 12,563,264 G436E probably damaging Het
Sf3b1 A T 1: 54,999,655 M823K probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Syne2 G T 12: 75,923,083 E977D probably null Het
Tns2 A T 15: 102,107,037 M125L possibly damaging Het
Ttn T A 2: 76,711,969 K31812* probably null Het
Ube4b G A 4: 149,425,996 probably benign Het
Vmn2r91 G A 17: 18,135,603 probably null Het
Zbtb49 G A 5: 38,203,087 probably null Het
Other mutations in Zswim8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zswim8 APN 14 20718475 missense probably damaging 0.99
IGL00470:Zswim8 APN 14 20723181 missense probably damaging 1.00
IGL00675:Zswim8 APN 14 20716901 unclassified probably benign
IGL00896:Zswim8 APN 14 20716001 missense probably damaging 1.00
IGL01343:Zswim8 APN 14 20713341 missense probably damaging 1.00
IGL01736:Zswim8 APN 14 20714712 missense probably benign 0.11
IGL01961:Zswim8 APN 14 20712334 missense possibly damaging 0.76
IGL02331:Zswim8 APN 14 20723257 missense probably damaging 1.00
IGL02485:Zswim8 APN 14 20711887 missense probably damaging 0.98
IGL02662:Zswim8 APN 14 20713074 missense probably benign 0.14
IGL03001:Zswim8 APN 14 20714391 missense probably damaging 1.00
R0123:Zswim8 UTSW 14 20716490 splice site probably benign
R0362:Zswim8 UTSW 14 20721945 missense possibly damaging 0.58
R0402:Zswim8 UTSW 14 20710766 missense probably damaging 1.00
R0458:Zswim8 UTSW 14 20718897 missense probably damaging 1.00
R1087:Zswim8 UTSW 14 20717865 splice site probably null
R1158:Zswim8 UTSW 14 20721668 splice site probably benign
R1171:Zswim8 UTSW 14 20713113 missense possibly damaging 0.94
R1389:Zswim8 UTSW 14 20710748 missense probably damaging 1.00
R1773:Zswim8 UTSW 14 20711530 missense probably damaging 0.96
R1780:Zswim8 UTSW 14 20716327 missense probably damaging 0.99
R1850:Zswim8 UTSW 14 20710747 nonsense probably null
R2421:Zswim8 UTSW 14 20719457 missense probably damaging 1.00
R3826:Zswim8 UTSW 14 20711089 nonsense probably null
R3965:Zswim8 UTSW 14 20713073 missense probably benign
R4301:Zswim8 UTSW 14 20713909 missense possibly damaging 0.91
R4499:Zswim8 UTSW 14 20714297 missense probably benign 0.05
R4633:Zswim8 UTSW 14 20718823 missense probably damaging 1.00
R4675:Zswim8 UTSW 14 20714613 missense probably benign
R4958:Zswim8 UTSW 14 20713465 missense probably damaging 1.00
R5255:Zswim8 UTSW 14 20721651 missense probably damaging 1.00
R5288:Zswim8 UTSW 14 20718871 missense possibly damaging 0.92
R5341:Zswim8 UTSW 14 20716054 missense probably damaging 1.00
R5495:Zswim8 UTSW 14 20722286 missense probably damaging 0.97
R5652:Zswim8 UTSW 14 20713427 missense possibly damaging 0.62
R6273:Zswim8 UTSW 14 20713453 missense probably benign 0.06
R6281:Zswim8 UTSW 14 20714640 missense probably benign 0.02
R6364:Zswim8 UTSW 14 20713011 missense probably damaging 1.00
R6576:Zswim8 UTSW 14 20721874 missense probably benign 0.41
R6798:Zswim8 UTSW 14 20715992 missense probably damaging 1.00
R7059:Zswim8 UTSW 14 20714573 splice site probably null
R7243:Zswim8 UTSW 14 20714368 missense probably damaging 1.00
R7250:Zswim8 UTSW 14 20719968 missense probably damaging 1.00
R7311:Zswim8 UTSW 14 20721484 missense probably damaging 1.00
X0026:Zswim8 UTSW 14 20710632 splice site probably null
X0028:Zswim8 UTSW 14 20714657 missense probably benign 0.19
X0058:Zswim8 UTSW 14 20712990 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTAGGCTGCTTCAAGAAGAAAG -3'
(R):5'- ATAGAACACTGGGGTGAGCC -3'

Sequencing Primer
(F):5'- CTGCTTCAAGAAGAAAGGAAGATAAC -3'
(R):5'- AGGGCACAACCTGACTGGAC -3'
Posted On2018-05-24