Mutagenetix > Incidental Mutation

Incidental Mutation 'R6426:Zswim8'

518332

Institutional Source

Beutler Lab

Gene Symbol

Zswim8

Ensembl Gene

ENSMUSG00000021819

Gene Name

zinc finger SWIM-type containing 8

Synonyms

2310021P13Rik, 4832404P21Rik

MMRRC Submission

044565-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R6426 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20757620-20773687 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20768594 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1035 (S1035T)

Ref Sequence

ENSEMBL: ENSMUSP00000153285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224751]

AlphaFold

Q3UHH1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022358
AA Change: S1042T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: S1042T

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC
low complexity region	89	102	N/A	INTRINSIC
low complexity region	390	405	N/A	INTRINSIC
low complexity region	578	612	N/A	INTRINSIC
low complexity region	736	751	N/A	INTRINSIC
low complexity region	1000	1015	N/A	INTRINSIC
low complexity region	1120	1135	N/A	INTRINSIC
low complexity region	1176	1211	N/A	INTRINSIC
low complexity region	1259	1270	N/A	INTRINSIC
low complexity region	1343	1355	N/A	INTRINSIC
low complexity region	1470	1487	N/A	INTRINSIC
low complexity region	1491	1511	N/A	INTRINSIC
low complexity region	1527	1542	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223561

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223782

Predicted Effect

probably damaging
Transcript: ENSMUST00000223840
AA Change: S1008T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224485

Predicted Effect

probably damaging
Transcript: ENSMUST00000224751
AA Change: S1035T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225187

Predicted Effect

probably benign
Transcript: ENSMUST00000225911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225743

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.5%

Validation Efficiency

100% (34/34)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	C	T	16: 8,420,300 (GRCm39)		probably benign	Het
Adcyap1r1	T	G	6: 55,471,172 (GRCm39)	L365R	probably damaging	Het
Adgre4	A	G	17: 56,109,196 (GRCm39)	N401S	probably benign	Het
Adgrl3	A	T	5: 81,874,717 (GRCm39)	S1073C	probably damaging	Het
Bicral	G	A	17: 47,141,005 (GRCm39)	P26S	probably benign	Het
Cst3	G	T	2: 148,713,917 (GRCm39)	T129K	probably benign	Het
Cyp26a1	T	C	19: 37,687,753 (GRCm39)	M287T	probably benign	Het
Daam2	C	T	17: 49,776,404 (GRCm39)	E828K	probably damaging	Het
Dmxl1	T	C	18: 49,997,645 (GRCm39)	V611A	probably damaging	Het
Fam149a	C	A	8: 45,834,611 (GRCm39)	A63S	probably benign	Het
Fhip2a	T	G	19: 57,371,610 (GRCm39)	L574R	probably damaging	Het
Foxred2	C	G	15: 77,837,508 (GRCm39)	A243P	probably damaging	Het
Gm3604	A	T	13: 62,517,436 (GRCm39)	D307E	probably damaging	Het
Lca5	G	A	9: 83,277,707 (GRCm39)	Q546*	probably null	Het
Mfsd4b1	T	C	10: 39,882,073 (GRCm39)	T71A	possibly damaging	Het
Onecut1	A	G	9: 74,769,631 (GRCm39)	H18R	probably damaging	Het
Or5a1	A	G	19: 12,097,212 (GRCm39)	V288A	probably benign	Het
Paqr7	A	G	4: 134,234,278 (GRCm39)	Y45C	probably damaging	Het
Pcsk5	G	T	19: 17,595,093 (GRCm39)	Q414K	probably damaging	Het
Ppp4r2	T	C	6: 100,829,558 (GRCm39)	Y77H	probably damaging	Het
Prr19	A	G	7: 25,003,262 (GRCm39)	D292G	probably damaging	Het
Pum1	G	A	4: 130,481,283 (GRCm39)	R464H	probably damaging	Het
Rhoq	G	T	17: 87,302,442 (GRCm39)	R126L	probably damaging	Het
Sdhb	A	G	4: 140,701,029 (GRCm39)	K162E	probably benign	Het
Sema3d	G	A	5: 12,613,231 (GRCm39)	G436E	probably damaging	Het
Sf3b1	A	T	1: 55,038,814 (GRCm39)	M823K	probably benign	Het
Smc1b	C	T	15: 84,976,232 (GRCm39)	R825Q	probably benign	Het
Syne2	G	T	12: 75,969,857 (GRCm39)	E977D	probably null	Het
Tns2	A	T	15: 102,015,472 (GRCm39)	M125L	possibly damaging	Het
Ttn	T	A	2: 76,542,313 (GRCm39)	K31812*	probably null	Het
Ube4b	G	A	4: 149,510,453 (GRCm39)		probably benign	Het
Vmn2r91	G	A	17: 18,355,865 (GRCm39)		probably null	Het
Zbtb49	G	A	5: 38,360,431 (GRCm39)		probably null	Het

Other mutations in Zswim8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Zswim8	APN	14	20,768,543 (GRCm39)	missense	probably damaging	0.99
IGL00470:Zswim8	APN	14	20,773,249 (GRCm39)	missense	probably damaging	1.00
IGL00675:Zswim8	APN	14	20,766,969 (GRCm39)	unclassified	probably benign
IGL00896:Zswim8	APN	14	20,766,069 (GRCm39)	missense	probably damaging	1.00
IGL01343:Zswim8	APN	14	20,763,409 (GRCm39)	missense	probably damaging	1.00
IGL01736:Zswim8	APN	14	20,764,780 (GRCm39)	missense	probably benign	0.11
IGL01961:Zswim8	APN	14	20,762,402 (GRCm39)	missense	possibly damaging	0.76
IGL02331:Zswim8	APN	14	20,773,325 (GRCm39)	missense	probably damaging	1.00
IGL02485:Zswim8	APN	14	20,761,955 (GRCm39)	missense	probably damaging	0.98
IGL02662:Zswim8	APN	14	20,763,142 (GRCm39)	missense	probably benign	0.14
IGL03001:Zswim8	APN	14	20,764,459 (GRCm39)	missense	probably damaging	1.00
pool	UTSW	14	20,764,641 (GRCm39)	splice site	probably null
R0123:Zswim8	UTSW	14	20,766,558 (GRCm39)	splice site	probably benign
R0362:Zswim8	UTSW	14	20,772,013 (GRCm39)	missense	possibly damaging	0.58
R0402:Zswim8	UTSW	14	20,760,834 (GRCm39)	missense	probably damaging	1.00
R0458:Zswim8	UTSW	14	20,768,965 (GRCm39)	missense	probably damaging	1.00
R1087:Zswim8	UTSW	14	20,767,933 (GRCm39)	splice site	probably null
R1158:Zswim8	UTSW	14	20,771,736 (GRCm39)	splice site	probably benign
R1171:Zswim8	UTSW	14	20,763,181 (GRCm39)	missense	possibly damaging	0.94
R1389:Zswim8	UTSW	14	20,760,816 (GRCm39)	missense	probably damaging	1.00
R1773:Zswim8	UTSW	14	20,761,598 (GRCm39)	missense	probably damaging	0.96
R1780:Zswim8	UTSW	14	20,766,395 (GRCm39)	missense	probably damaging	0.99
R1850:Zswim8	UTSW	14	20,760,815 (GRCm39)	nonsense	probably null
R2421:Zswim8	UTSW	14	20,769,525 (GRCm39)	missense	probably damaging	1.00
R3826:Zswim8	UTSW	14	20,761,157 (GRCm39)	nonsense	probably null
R3965:Zswim8	UTSW	14	20,763,141 (GRCm39)	missense	probably benign
R4301:Zswim8	UTSW	14	20,763,977 (GRCm39)	missense	possibly damaging	0.91
R4499:Zswim8	UTSW	14	20,764,365 (GRCm39)	missense	probably benign	0.05
R4633:Zswim8	UTSW	14	20,768,891 (GRCm39)	missense	probably damaging	1.00
R4675:Zswim8	UTSW	14	20,764,681 (GRCm39)	missense	probably benign
R4958:Zswim8	UTSW	14	20,763,533 (GRCm39)	missense	probably damaging	1.00
R5255:Zswim8	UTSW	14	20,771,719 (GRCm39)	missense	probably damaging	1.00
R5288:Zswim8	UTSW	14	20,768,939 (GRCm39)	missense	possibly damaging	0.92
R5341:Zswim8	UTSW	14	20,766,122 (GRCm39)	missense	probably damaging	1.00
R5495:Zswim8	UTSW	14	20,772,354 (GRCm39)	missense	probably damaging	0.97
R5652:Zswim8	UTSW	14	20,763,495 (GRCm39)	missense	possibly damaging	0.62
R6273:Zswim8	UTSW	14	20,763,521 (GRCm39)	missense	probably benign	0.06
R6281:Zswim8	UTSW	14	20,764,708 (GRCm39)	missense	probably benign	0.02
R6364:Zswim8	UTSW	14	20,763,079 (GRCm39)	missense	probably damaging	1.00
R6576:Zswim8	UTSW	14	20,771,942 (GRCm39)	missense	probably benign	0.41
R6798:Zswim8	UTSW	14	20,766,060 (GRCm39)	missense	probably damaging	1.00
R7059:Zswim8	UTSW	14	20,764,641 (GRCm39)	splice site	probably null
R7243:Zswim8	UTSW	14	20,764,436 (GRCm39)	missense	probably damaging	1.00
R7250:Zswim8	UTSW	14	20,770,036 (GRCm39)	missense	probably damaging	1.00
R7311:Zswim8	UTSW	14	20,771,552 (GRCm39)	missense	probably damaging	1.00
R7567:Zswim8	UTSW	14	20,770,001 (GRCm39)	missense	probably damaging	1.00
R7635:Zswim8	UTSW	14	20,766,368 (GRCm39)	missense	probably damaging	0.99
R7771:Zswim8	UTSW	14	20,763,048 (GRCm39)	missense	probably damaging	1.00
R7874:Zswim8	UTSW	14	20,773,217 (GRCm39)	missense	probably damaging	0.98
R7994:Zswim8	UTSW	14	20,758,072 (GRCm39)	missense	possibly damaging	0.95
R8466:Zswim8	UTSW	14	20,760,744 (GRCm39)	missense	possibly damaging	0.93
R9019:Zswim8	UTSW	14	20,761,119 (GRCm39)	missense	probably damaging	1.00
R9177:Zswim8	UTSW	14	20,761,908 (GRCm39)	missense	probably damaging	1.00
R9192:Zswim8	UTSW	14	20,769,588 (GRCm39)	missense	probably damaging	1.00
R9229:Zswim8	UTSW	14	20,766,393 (GRCm39)	missense	probably benign	0.45
R9268:Zswim8	UTSW	14	20,761,908 (GRCm39)	missense	probably damaging	1.00
R9562:Zswim8	UTSW	14	20,762,150 (GRCm39)	nonsense	probably null
R9589:Zswim8	UTSW	14	20,763,171 (GRCm39)	missense	probably damaging	0.99
R9621:Zswim8	UTSW	14	20,772,231 (GRCm39)	missense	probably benign	0.00
X0026:Zswim8	UTSW	14	20,760,700 (GRCm39)	splice site	probably null
X0028:Zswim8	UTSW	14	20,764,725 (GRCm39)	missense	probably benign	0.19
X0058:Zswim8	UTSW	14	20,763,058 (GRCm39)	missense	probably damaging	0.99
Z1177:Zswim8	UTSW	14	20,763,112 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTAGGCTGCTTCAAGAAGAAAG -3'
(R):5'- ATAGAACACTGGGGTGAGCC -3'

Sequencing Primer
(F):5'- CTGCTTCAAGAAGAAAGGAAGATAAC -3'
(R):5'- AGGGCACAACCTGACTGGAC -3'

Posted On

2018-05-24