Incidental Mutation 'R4958:Zswim8'
ID381725
Institutional Source Beutler Lab
Gene Symbol Zswim8
Ensembl Gene ENSMUSG00000021819
Gene Namezinc finger SWIM-type containing 8
Synonyms2310021P13Rik, 4832404P21Rik
MMRRC Submission 042555-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4958 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20707552-20723619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20713465 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 427 (W427R)
Ref Sequence ENSEMBL: ENSMUSP00000153285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]
Predicted Effect probably damaging
Transcript: ENSMUST00000022358
AA Change: W427R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: W427R

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably damaging
Transcript: ENSMUST00000223840
AA Change: W427R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000224129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224165
Predicted Effect probably damaging
Transcript: ENSMUST00000224751
AA Change: W427R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225743
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd7 A G 6: 18,866,723 S81G probably benign Het
Arel1 T C 12: 84,926,304 K573R possibly damaging Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp1a4 T A 1: 172,231,151 D909V probably damaging Het
Cdh2 T G 18: 16,627,565 probably null Het
Col6a1 A T 10: 76,723,505 I99N probably damaging Het
Dennd4c A G 4: 86,781,679 T256A probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ereg T C 5: 91,090,111 V152A probably damaging Het
Gm4950 T C 18: 51,865,569 T105A probably benign Het
Hsf2 T C 10: 57,501,371 I121T probably damaging Het
Kmt2a A T 9: 44,848,467 L728Q probably damaging Het
Llgl1 G T 11: 60,711,435 R768L probably benign Het
Lyst A G 13: 13,635,463 I573V probably benign Het
Macf1 G T 4: 123,475,364 T303K probably damaging Het
Map3k5 A T 10: 20,023,789 Q264L possibly damaging Het
Mboat1 T C 13: 30,224,393 S180P probably damaging Het
Mfsd6 T C 1: 52,661,024 D655G probably damaging Het
Myh2 A G 11: 67,192,959 E1521G possibly damaging Het
Nsd2 T A 5: 33,892,022 S1200R probably damaging Het
Olfr1099 T C 2: 86,959,105 M118V possibly damaging Het
Olfr1336 G A 7: 6,461,058 C183Y probably damaging Het
Olfr633 T C 7: 103,946,601 F12L probably damaging Het
Olfr667 T C 7: 104,916,461 I278M probably damaging Het
Pbrm1 T C 14: 31,074,827 I875T probably damaging Het
Pla2g1b T A 5: 115,470,826 F26I probably damaging Het
Plscr4 A G 9: 92,484,761 N143D possibly damaging Het
Rab11fip1 G T 8: 27,154,813 R315S probably damaging Het
Rptor G A 11: 119,857,391 R727Q probably benign Het
Serac1 A T 17: 6,069,382 V91D probably benign Het
Slco1a6 C A 6: 142,145,705 G90C probably damaging Het
Sulf1 A G 1: 12,796,910 Y106C probably benign Het
Syt13 G A 2: 92,953,449 V355M probably damaging Het
Tjp1 G A 7: 65,336,102 R314* probably null Het
Tshr A G 12: 91,538,187 D633G probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Znrf4 A G 17: 56,511,701 F202S probably damaging Het
Other mutations in Zswim8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zswim8 APN 14 20718475 missense probably damaging 0.99
IGL00470:Zswim8 APN 14 20723181 missense probably damaging 1.00
IGL00675:Zswim8 APN 14 20716901 unclassified probably benign
IGL00896:Zswim8 APN 14 20716001 missense probably damaging 1.00
IGL01343:Zswim8 APN 14 20713341 missense probably damaging 1.00
IGL01736:Zswim8 APN 14 20714712 missense probably benign 0.11
IGL01961:Zswim8 APN 14 20712334 missense possibly damaging 0.76
IGL02331:Zswim8 APN 14 20723257 missense probably damaging 1.00
IGL02485:Zswim8 APN 14 20711887 missense probably damaging 0.98
IGL02662:Zswim8 APN 14 20713074 missense probably benign 0.14
IGL03001:Zswim8 APN 14 20714391 missense probably damaging 1.00
R0123:Zswim8 UTSW 14 20716490 splice site probably benign
R0362:Zswim8 UTSW 14 20721945 missense possibly damaging 0.58
R0402:Zswim8 UTSW 14 20710766 missense probably damaging 1.00
R0458:Zswim8 UTSW 14 20718897 missense probably damaging 1.00
R1087:Zswim8 UTSW 14 20717865 splice site probably null
R1158:Zswim8 UTSW 14 20721668 splice site probably benign
R1171:Zswim8 UTSW 14 20713113 missense possibly damaging 0.94
R1389:Zswim8 UTSW 14 20710748 missense probably damaging 1.00
R1773:Zswim8 UTSW 14 20711530 missense probably damaging 0.96
R1780:Zswim8 UTSW 14 20716327 missense probably damaging 0.99
R1850:Zswim8 UTSW 14 20710747 nonsense probably null
R2421:Zswim8 UTSW 14 20719457 missense probably damaging 1.00
R3826:Zswim8 UTSW 14 20711089 nonsense probably null
R3965:Zswim8 UTSW 14 20713073 missense probably benign
R4301:Zswim8 UTSW 14 20713909 missense possibly damaging 0.91
R4499:Zswim8 UTSW 14 20714297 missense probably benign 0.05
R4633:Zswim8 UTSW 14 20718823 missense probably damaging 1.00
R4675:Zswim8 UTSW 14 20714613 missense probably benign
R5255:Zswim8 UTSW 14 20721651 missense probably damaging 1.00
R5288:Zswim8 UTSW 14 20718871 missense possibly damaging 0.92
R5341:Zswim8 UTSW 14 20716054 missense probably damaging 1.00
R5495:Zswim8 UTSW 14 20722286 missense probably damaging 0.97
R5652:Zswim8 UTSW 14 20713427 missense possibly damaging 0.62
R6273:Zswim8 UTSW 14 20713453 missense probably benign 0.06
R6281:Zswim8 UTSW 14 20714640 missense probably benign 0.02
R6364:Zswim8 UTSW 14 20713011 missense probably damaging 1.00
R6426:Zswim8 UTSW 14 20718526 missense probably damaging 0.99
R6576:Zswim8 UTSW 14 20721874 missense probably benign 0.41
R6798:Zswim8 UTSW 14 20715992 missense probably damaging 1.00
R7059:Zswim8 UTSW 14 20714573 splice site probably null
R7243:Zswim8 UTSW 14 20714368 missense probably damaging 1.00
R7250:Zswim8 UTSW 14 20719968 missense probably damaging 1.00
R7311:Zswim8 UTSW 14 20721484 missense probably damaging 1.00
X0026:Zswim8 UTSW 14 20710632 splice site probably null
X0028:Zswim8 UTSW 14 20714657 missense probably benign 0.19
X0058:Zswim8 UTSW 14 20712990 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGCCTCACCTATGAACAGG -3'
(R):5'- GTAGTCACCTCAGTGCTCAG -3'

Sequencing Primer
(F):5'- TTTATTCTGACAGGAACATAGAGGAG -3'
(R):5'- AGCACTTCCCATTCCCCTAGG -3'
Posted On2016-04-27