Incidental Mutation 'R3826:Zswim8'
ID275426
Institutional Source Beutler Lab
Gene Symbol Zswim8
Ensembl Gene ENSMUSG00000021819
Gene Namezinc finger SWIM-type containing 8
Synonyms2310021P13Rik, 4832404P21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20707552-20723619 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 20711089 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 142 (R142*)
Ref Sequence ENSEMBL: ENSMUSP00000153285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]
Predicted Effect probably null
Transcript: ENSMUST00000022358
AA Change: R142*
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: R142*

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably null
Transcript: ENSMUST00000223840
AA Change: R142*
Predicted Effect probably benign
Transcript: ENSMUST00000224129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224165
Predicted Effect probably null
Transcript: ENSMUST00000224751
AA Change: R142*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225743
Meta Mutation Damage Score 0.6364 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Other mutations in Zswim8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zswim8 APN 14 20718475 missense probably damaging 0.99
IGL00470:Zswim8 APN 14 20723181 missense probably damaging 1.00
IGL00675:Zswim8 APN 14 20716901 unclassified probably benign
IGL00896:Zswim8 APN 14 20716001 missense probably damaging 1.00
IGL01343:Zswim8 APN 14 20713341 missense probably damaging 1.00
IGL01736:Zswim8 APN 14 20714712 missense probably benign 0.11
IGL01961:Zswim8 APN 14 20712334 missense possibly damaging 0.76
IGL02331:Zswim8 APN 14 20723257 missense probably damaging 1.00
IGL02485:Zswim8 APN 14 20711887 missense probably damaging 0.98
IGL02662:Zswim8 APN 14 20713074 missense probably benign 0.14
IGL03001:Zswim8 APN 14 20714391 missense probably damaging 1.00
R0123:Zswim8 UTSW 14 20716490 splice site probably benign
R0362:Zswim8 UTSW 14 20721945 missense possibly damaging 0.58
R0402:Zswim8 UTSW 14 20710766 missense probably damaging 1.00
R0458:Zswim8 UTSW 14 20718897 missense probably damaging 1.00
R1087:Zswim8 UTSW 14 20717865 splice site probably null
R1158:Zswim8 UTSW 14 20721668 splice site probably benign
R1171:Zswim8 UTSW 14 20713113 missense possibly damaging 0.94
R1389:Zswim8 UTSW 14 20710748 missense probably damaging 1.00
R1773:Zswim8 UTSW 14 20711530 missense probably damaging 0.96
R1780:Zswim8 UTSW 14 20716327 missense probably damaging 0.99
R1850:Zswim8 UTSW 14 20710747 nonsense probably null
R2421:Zswim8 UTSW 14 20719457 missense probably damaging 1.00
R3965:Zswim8 UTSW 14 20713073 missense probably benign
R4301:Zswim8 UTSW 14 20713909 missense possibly damaging 0.91
R4499:Zswim8 UTSW 14 20714297 missense probably benign 0.05
R4633:Zswim8 UTSW 14 20718823 missense probably damaging 1.00
R4675:Zswim8 UTSW 14 20714613 missense probably benign
R4958:Zswim8 UTSW 14 20713465 missense probably damaging 1.00
R5255:Zswim8 UTSW 14 20721651 missense probably damaging 1.00
R5288:Zswim8 UTSW 14 20718871 missense possibly damaging 0.92
R5341:Zswim8 UTSW 14 20716054 missense probably damaging 1.00
R5495:Zswim8 UTSW 14 20722286 missense probably damaging 0.97
R5652:Zswim8 UTSW 14 20713427 missense possibly damaging 0.62
R6273:Zswim8 UTSW 14 20713453 missense probably benign 0.06
R6281:Zswim8 UTSW 14 20714640 missense probably benign 0.02
R6364:Zswim8 UTSW 14 20713011 missense probably damaging 1.00
R6426:Zswim8 UTSW 14 20718526 missense probably damaging 0.99
R6576:Zswim8 UTSW 14 20721874 missense probably benign 0.41
R6798:Zswim8 UTSW 14 20715992 missense probably damaging 1.00
R7059:Zswim8 UTSW 14 20714573 splice site probably null
R7243:Zswim8 UTSW 14 20714368 missense probably damaging 1.00
R7250:Zswim8 UTSW 14 20719968 missense probably damaging 1.00
R7311:Zswim8 UTSW 14 20721484 missense probably damaging 1.00
X0026:Zswim8 UTSW 14 20710632 splice site probably null
X0028:Zswim8 UTSW 14 20714657 missense probably benign 0.19
X0058:Zswim8 UTSW 14 20712990 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCTTTCTGCAGAACAAAAG -3'
(R):5'- AGCTGGCCAAGACCAAAGTC -3'

Sequencing Primer
(F):5'- TACTGTAGTTGGAACTGCTAAGAG -3'
(R):5'- CTGTCTTAGAACTCACTATGGAGACC -3'
Posted On2015-04-02