Incidental Mutation 'R6436:Arc'
ID518787
Institutional Source Beutler Lab
Gene Symbol Arc
Ensembl Gene ENSMUSG00000022602
Gene Nameactivity regulated cytoskeletal-associated protein
SynonymsArc3.1, arg 3.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6436 (G1)
Quality Score133.008
Status Validated
Chromosome15
Chromosomal Location74669083-74672570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74672249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 42 (V42L)
Ref Sequence ENSEMBL: ENSMUSP00000105636 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000023268
AA Change: V42L

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000110009
AA Change: V42L

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in embryonic lethality around E6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Pdcd4 A G 19: 53,926,931 probably null Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Arc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Arc APN 15 74672355 missense probably benign
IGL02372:Arc APN 15 74672105 missense probably damaging 1.00
IGL03209:Arc APN 15 74671984 missense probably damaging 1.00
P0040:Arc UTSW 15 74671339 missense probably damaging 1.00
R0732:Arc UTSW 15 74671195 missense probably damaging 1.00
R1377:Arc UTSW 15 74672252 missense possibly damaging 0.51
R2430:Arc UTSW 15 74671891 missense probably benign 0.01
R4647:Arc UTSW 15 74671525 missense probably damaging 1.00
R4855:Arc UTSW 15 74671743 missense probably benign 0.01
R6743:Arc UTSW 15 74671787 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCTCCAGACGGTAGAAG -3'
(R):5'- TCAGAGGAGTTCTTAGCCTGTTC -3'

Sequencing Primer
(F):5'- GCATCTCACGCTTGACCCAG -3'
(R):5'- AGTTCTTAGCCTGTTCGGAGCC -3'
Posted On2018-05-24