Incidental Mutation 'R6536:Ifi44'
ID520397
Institutional Source Beutler Lab
Gene Symbol Ifi44
Ensembl Gene ENSMUSG00000028037
Gene Nameinterferon-induced protein 44
SynonymsA430056A10Rik, p44, MTAP44
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location151730922-151749960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151732489 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 387 (V387A)
Ref Sequence ENSEMBL: ENSMUSP00000029671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029671]
Predicted Effect probably benign
Transcript: ENSMUST00000029671
AA Change: V387A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029671
Gene: ENSMUSG00000028037
AA Change: V387A

DomainStartEndE-ValueType
Pfam:TLD 26 147 2.8e-7 PFAM
low complexity region 193 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149919
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Ifi44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ifi44 APN 3 151749580 missense probably benign 0.03
IGL01477:Ifi44 APN 3 151745998 splice site probably benign
IGL01571:Ifi44 APN 3 151745537 missense probably damaging 0.97
IGL02165:Ifi44 APN 3 151749430 missense probably damaging 1.00
IGL02238:Ifi44 APN 3 151732382 makesense probably null
IGL02609:Ifi44 APN 3 151732497 missense probably damaging 1.00
IGL02650:Ifi44 APN 3 151745855 missense probably damaging 1.00
IGL02726:Ifi44 APN 3 151749596 start gained probably benign
IGL02977:Ifi44 APN 3 151739379 missense probably benign 0.00
R0201:Ifi44 UTSW 3 151745636 missense probably damaging 1.00
R0454:Ifi44 UTSW 3 151745497 missense possibly damaging 0.78
R0763:Ifi44 UTSW 3 151749498 missense probably damaging 1.00
R1640:Ifi44 UTSW 3 151732534 missense probably benign 0.00
R1747:Ifi44 UTSW 3 151749285 missense probably benign 0.00
R2278:Ifi44 UTSW 3 151732388 missense probably benign
R3816:Ifi44 UTSW 3 151749257 missense possibly damaging 0.92
R4075:Ifi44 UTSW 3 151745976 missense probably benign 0.00
R4084:Ifi44 UTSW 3 151745489 critical splice donor site probably null
R4782:Ifi44 UTSW 3 151745592 missense probably damaging 0.99
R5071:Ifi44 UTSW 3 151749632 start gained probably benign
R5074:Ifi44 UTSW 3 151749632 start gained probably benign
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6030:Ifi44 UTSW 3 151749558 missense probably benign 0.00
R6128:Ifi44 UTSW 3 151749186 missense probably benign 0.00
R6192:Ifi44 UTSW 3 151745639 critical splice acceptor site probably null
R6434:Ifi44 UTSW 3 151749189 missense probably benign 0.02
R6902:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R6946:Ifi44 UTSW 3 151745899 missense possibly damaging 0.92
R7346:Ifi44 UTSW 3 151732457 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCCAGACAAGAATTGGCC -3'
(R):5'- TGATCACCAAGCTCCTAGTTC -3'

Sequencing Primer
(F):5'- GGCCAAGTTGATGATACCGTC -3'
(R):5'- CAAAGATTCTCGCTGAACTTGGAGC -3'
Posted On2018-06-06