Incidental Mutation 'R6623:Klc1'
ID524619
Institutional Source Beutler Lab
Gene Symbol Klc1
Ensembl Gene ENSMUSG00000021288
Gene Namekinesin light chain 1
SynonymsKns2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R6623 (G1)
Quality Score89.0077
Status Validated
Chromosome12
Chromosomal Location111758849-111807844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111806041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 597 (N597K)
Ref Sequence ENSEMBL: ENSMUSP00000113997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021715] [ENSMUST00000084941] [ENSMUST00000122300] [ENSMUST00000127281] [ENSMUST00000134578]
Predicted Effect probably benign
Transcript: ENSMUST00000021715
SMART Domains Protein: ENSMUSP00000021715
Gene: ENSMUSG00000021287

DomainStartEndE-ValueType
Pfam:Rad51 64 343 1.2e-25 PFAM
Pfam:AAA_25 70 261 2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084941
AA Change: N605K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288
AA Change: N605K

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.1e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122300
AA Change: N597K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288
AA Change: N597K

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 1e-68 PFAM
Pfam:TPR_10 212 253 8.4e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 2.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124064
Predicted Effect probably benign
Transcript: ENSMUST00000127281
SMART Domains Protein: ENSMUSP00000118040
Gene: ENSMUSG00000021287

DomainStartEndE-ValueType
Pfam:Rad51 64 193 4e-17 PFAM
Pfam:AAA_25 70 192 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132177
Predicted Effect silent
Transcript: ENSMUST00000134578
SMART Domains Protein: ENSMUSP00000120491
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:TPR_1 1 25 1.9e-4 PFAM
Pfam:TPR_7 1 36 1.9e-4 PFAM
Pfam:TPR_10 75 112 7.8e-9 PFAM
Pfam:TPR_1 77 98 1.4e-4 PFAM
Pfam:TPR_7 78 129 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147203
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are significantly smaller than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A T 2: 148,850,762 I40K probably benign Het
Abcc10 T C 17: 46,323,462 K460E probably damaging Het
Acaca A C 11: 84,371,499 probably null Het
Adamts1 A G 16: 85,795,637 S628P probably benign Het
Ankrd13a A G 5: 114,786,757 N101S probably benign Het
Asic5 G A 3: 82,008,585 V281M probably damaging Het
Atxn7 T C 14: 14,099,972 S553P probably damaging Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Homo
Hmcn1 A G 1: 150,758,306 F843S probably benign Het
Igkv10-96 T G 6: 68,632,174 S46R probably damaging Het
Itfg2 G T 6: 128,411,657 A289D probably damaging Het
Lnx2 A G 5: 147,024,487 V545A probably damaging Het
Map3k11 A G 19: 5,695,603 I344V probably damaging Het
Muc6 G A 7: 141,639,559 probably benign Het
Myrf C A 19: 10,223,359 A317S probably benign Het
Ncoa2 A T 1: 13,181,297 C251S probably damaging Het
Olfr556 T G 7: 102,670,034 M38R possibly damaging Het
Pcdhb12 C T 18: 37,437,658 T619I possibly damaging Het
Plxna1 A T 6: 89,322,771 M1672K probably damaging Het
Prl G T 13: 27,061,509 V72L probably benign Het
Prokr2 G T 2: 132,373,574 N161K probably damaging Het
Ryr2 T C 13: 11,710,065 D2454G probably damaging Het
Slc2a12 T A 10: 22,664,900 M218K probably damaging Het
Sorcs3 C T 19: 48,788,505 A992V probably benign Het
Stxbp2 T C 8: 3,632,561 I50T probably damaging Het
Supt20 A G 3: 54,718,294 I570M possibly damaging Het
Sv2b T A 7: 75,206,384 I53F probably damaging Het
Vmn1r113 T A 7: 20,788,066 M261K probably benign Het
Vmn1r217 T A 13: 23,114,676 I19F possibly damaging Het
Vmn2r45 T C 7: 8,471,501 T843A probably benign Het
Vmn2r69 T A 7: 85,407,101 I610L possibly damaging Het
Other mutations in Klc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Klc1 APN 12 111776884 missense probably damaging 1.00
IGL00940:Klc1 APN 12 111787498 missense probably damaging 1.00
IGL02206:Klc1 APN 12 111778116 unclassified probably benign
IGL02487:Klc1 APN 12 111772452 missense probably damaging 0.99
IGL02490:Klc1 APN 12 111781776 missense possibly damaging 0.89
IGL02830:Klc1 APN 12 111776907 missense probably damaging 0.99
IGL03121:Klc1 APN 12 111781642 unclassified probably benign
IGL03253:Klc1 APN 12 111781644 unclassified probably benign
IGL03376:Klc1 APN 12 111775953 missense probably damaging 0.97
dwarf UTSW 12 111795603 missense probably damaging 1.00
F5770:Klc1 UTSW 12 111774572 missense probably benign 0.09
R0031:Klc1 UTSW 12 111777033 missense probably damaging 0.99
R0239:Klc1 UTSW 12 111785324 splice site probably benign
R1647:Klc1 UTSW 12 111776887 missense probably damaging 1.00
R1648:Klc1 UTSW 12 111776887 missense probably damaging 1.00
R1892:Klc1 UTSW 12 111781827 critical splice donor site probably null
R2940:Klc1 UTSW 12 111806017 missense possibly damaging 0.49
R4829:Klc1 UTSW 12 111795603 missense probably damaging 1.00
R4849:Klc1 UTSW 12 111781695 missense probably damaging 1.00
R5309:Klc1 UTSW 12 111795621 missense possibly damaging 0.82
R5312:Klc1 UTSW 12 111795621 missense possibly damaging 0.82
R5637:Klc1 UTSW 12 111774408 missense probably damaging 1.00
R5706:Klc1 UTSW 12 111795627 missense possibly damaging 0.65
R6920:Klc1 UTSW 12 111787585 missense probably damaging 1.00
R7109:Klc1 UTSW 12 111776865 missense probably benign 0.22
V7580:Klc1 UTSW 12 111774572 missense probably benign 0.09
V7581:Klc1 UTSW 12 111774572 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGCTTGAAGTTTCAGCCAG -3'
(R):5'- CAATGGGAGAAGTCAGTGCC -3'

Sequencing Primer
(F):5'- AGCCAGGGCCTTCATATTG -3'
(R):5'- GAAGTCAGTGCCAGCCTCAAG -3'
Posted On2018-06-22