Incidental Mutation 'R6656:Bhlhe40'
ID 526619
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 044777-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6656 (G1)
Quality Score 217.468
Status Validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108641818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 T C 1: 179,581,078 (GRCm39) N1708S probably benign Het
Ahnak2 C T 12: 112,748,991 (GRCm39) M285I probably benign Het
Angptl1 A T 1: 156,684,806 (GRCm39) D325V probably damaging Het
Anln A T 9: 22,262,298 (GRCm39) V931E probably damaging Het
Ascc3 C T 10: 50,526,021 (GRCm39) R578* probably null Het
B3galnt2 C T 13: 14,150,161 (GRCm39) A168V probably benign Het
Cd22 T C 7: 30,577,182 (GRCm39) I42V probably benign Het
Cyp2b19 C T 7: 26,466,280 (GRCm39) T361I probably benign Het
D930048N14Rik C A 11: 51,544,576 (GRCm39) probably benign Het
Ehf T C 2: 103,113,928 (GRCm39) N23S probably damaging Het
Eif2ak3 T A 6: 70,860,699 (GRCm39) I425N probably damaging Het
Fbxo4 C T 15: 4,005,305 (GRCm39) V192M probably damaging Het
Gm21190 T C 5: 15,730,849 (GRCm39) Q169R possibly damaging Het
Gngt1 A G 6: 3,994,246 (GRCm39) D8G possibly damaging Het
Ift140 T C 17: 25,251,147 (GRCm39) L31P probably damaging Het
Keg1 C T 19: 12,686,994 (GRCm39) Q8* probably null Het
Lama3 T A 18: 12,682,283 (GRCm39) M1083K possibly damaging Het
Lrp1b A T 2: 40,527,876 (GRCm39) Y68* probably null Het
Lyz3 A G 10: 117,071,534 (GRCm39) V115A probably benign Het
Mctp1 A T 13: 77,178,055 (GRCm39) K947N probably damaging Het
Muc5ac A G 7: 141,357,065 (GRCm39) Y1113C probably damaging Het
Myb C T 10: 21,028,844 (GRCm39) V85M probably damaging Het
Npas2 T G 1: 39,401,029 (GRCm39) S798A unknown Het
Or13a21 G T 7: 139,999,517 (GRCm39) H56Q probably damaging Het
Orc2 A G 1: 58,532,818 (GRCm39) probably null Het
Parpbp T C 10: 87,946,175 (GRCm39) T415A probably benign Het
Pcdha3 T C 18: 37,080,875 (GRCm39) V539A probably benign Het
Piwil4 T C 9: 14,621,230 (GRCm39) E601G probably damaging Het
Pramel51 A T 12: 88,142,763 (GRCm39) L285Q possibly damaging Het
Ptpn3 T A 4: 57,205,905 (GRCm39) I696F probably damaging Het
Sec63 C T 10: 42,692,379 (GRCm39) Q617* probably null Het
Sgip1 C A 4: 102,762,765 (GRCm39) probably benign Het
Sirpd T C 3: 15,385,558 (GRCm39) T115A probably damaging Het
Tktl2 T C 8: 66,965,381 (GRCm39) V313A probably benign Het
Tmem63b C A 17: 45,978,634 (GRCm39) R325L probably benign Het
Ttn C T 2: 76,539,700 (GRCm39) G34429R probably damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTGAAATCTTCCCAGCTCG -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2018-07-23