Incidental Mutation 'R6662:Cfap45'
ID528001
Institutional Source Beutler Lab
Gene Symbol Cfap45
Ensembl Gene ENSMUSG00000026546
Gene Namecilia and flagella associated protein 45
Synonyms1700028D05Rik, Nesg1, Ccdc19
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R6662 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172520801-172545870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172529850 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 15 (I15T)
Ref Sequence ENSEMBL: ENSMUSP00000125225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085894] [ENSMUST00000159395] [ENSMUST00000159792] [ENSMUST00000161140] [ENSMUST00000162988]
Predicted Effect probably benign
Transcript: ENSMUST00000085894
AA Change: I57T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000083057
Gene: ENSMUSG00000026546
AA Change: I57T

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:TPH 187 532 1.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159395
AA Change: I28T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125224
Gene: ENSMUSG00000026546
AA Change: I28T

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159792
AA Change: I28T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000124540
Gene: ENSMUSG00000026546
AA Change: I28T

DomainStartEndE-ValueType
coiled coil region 128 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160531
Predicted Effect probably benign
Transcript: ENSMUST00000161140
AA Change: I15T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000162988
AA Change: I28T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Garem1 T C 18: 21,148,247 N351D probably benign Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Cfap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Cfap45 APN 1 172535345 unclassified probably benign
IGL01936:Cfap45 APN 1 172534049 missense probably damaging 1.00
IGL03235:Cfap45 APN 1 172538493 missense possibly damaging 0.55
R0194:Cfap45 UTSW 1 172541327 missense probably benign 0.05
R0883:Cfap45 UTSW 1 172532189 missense possibly damaging 0.90
R1130:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1168:Cfap45 UTSW 1 172545697 missense probably damaging 1.00
R1356:Cfap45 UTSW 1 172527863 missense possibly damaging 0.53
R1522:Cfap45 UTSW 1 172540572 missense probably damaging 1.00
R1921:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R1922:Cfap45 UTSW 1 172545112 missense probably damaging 1.00
R2203:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2204:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R2205:Cfap45 UTSW 1 172532161 missense probably benign 0.28
R3156:Cfap45 UTSW 1 172545724 missense possibly damaging 0.93
R4059:Cfap45 UTSW 1 172538489 missense probably benign 0.00
R4151:Cfap45 UTSW 1 172532221 missense probably damaging 0.98
R4445:Cfap45 UTSW 1 172535227 missense probably benign 0.07
R4548:Cfap45 UTSW 1 172545108 missense probably benign 0.00
R4582:Cfap45 UTSW 1 172529912 missense probably benign 0.42
R4909:Cfap45 UTSW 1 172529876 missense probably benign 0.14
R5200:Cfap45 UTSW 1 172545129 nonsense probably null
R5800:Cfap45 UTSW 1 172538600 missense probably damaging 0.98
R6520:Cfap45 UTSW 1 172540584 missense probably damaging 1.00
R7390:Cfap45 UTSW 1 172541358 missense probably benign 0.00
R7468:Cfap45 UTSW 1 172535310 nonsense probably null
R7545:Cfap45 UTSW 1 172538596 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGGATGCTTCCCTAATACCG -3'
(R):5'- TCCAGTTTTGTGTACGTTAAGC -3'

Sequencing Primer
(F):5'- CGTAGGTGCTCTTGTGTTCTGTAG -3'
(R):5'- CCAGTTTTGTGTACGTTAAGCAAAAG -3'
Posted On2018-07-24