Incidental Mutation 'R6652:Vezt'
ID528101
Institutional Source Beutler Lab
Gene Symbol Vezt
Ensembl Gene ENSMUSG00000036099
Gene Namevezatin, adherens junctions transmembrane protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location93939165-94035817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93970279 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 757 (F757L)
Ref Sequence ENSEMBL: ENSMUSP00000113715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047711] [ENSMUST00000118077] [ENSMUST00000118205] [ENSMUST00000119818]
Predicted Effect probably damaging
Transcript: ENSMUST00000047711
AA Change: F753L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037955
Gene: ENSMUSG00000036099
AA Change: F753L

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1.6e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
low complexity region 702 715 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118077
SMART Domains Protein: ENSMUSP00000113983
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 9.2e-61 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118205
SMART Domains Protein: ENSMUSP00000113321
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119818
AA Change: F757L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113715
Gene: ENSMUSG00000036099
AA Change: F757L

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 150 442 1e-93 PFAM
low complexity region 570 585 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 768 783 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148450
SMART Domains Protein: ENSMUSP00000121105
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is essential for the formation of adherens junctions. It is required for both the pre-implantation morphogenesis of a blastocyst and for the implantation process. The encoded protein is also a component of the ankle-link complex in cochlear hair cells, where it may effect resilience to sound trauma. It is also thought to be involved in dendritic spine morphogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele develop to the blastocyst stage inducing a decidual response but die at implantation. Only about half of blastocysts are able to hatch upon in vitro culture and mutant outgrowths show severe defects in intercellular adhesion and signs of cellular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Vezt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Vezt APN 10 93996857 missense probably damaging 1.00
IGL01655:Vezt APN 10 93996997 missense probably benign 0.00
IGL02014:Vezt APN 10 93996949 missense probably benign 0.35
IGL03072:Vezt APN 10 93974033 missense probably damaging 1.00
R0542:Vezt UTSW 10 94007096 critical splice acceptor site probably null
R1633:Vezt UTSW 10 93984276 missense probably damaging 1.00
R1757:Vezt UTSW 10 93970563 missense probably benign
R1808:Vezt UTSW 10 93990164 missense probably damaging 1.00
R4296:Vezt UTSW 10 93973931 small deletion probably benign
R4972:Vezt UTSW 10 94000350 critical splice donor site probably null
R5079:Vezt UTSW 10 94020624 splice site probably null
R5137:Vezt UTSW 10 93970510 missense probably benign 0.00
R5319:Vezt UTSW 10 93970331 missense probably benign
R5743:Vezt UTSW 10 93997095 missense probably benign 0.01
R6002:Vezt UTSW 10 94000474 missense probably damaging 1.00
R6281:Vezt UTSW 10 93973946 missense probably benign 0.04
R6681:Vezt UTSW 10 93996997 missense probably benign 0.00
R6914:Vezt UTSW 10 93970451 missense probably benign
R7100:Vezt UTSW 10 93996933 missense probably benign 0.13
R7131:Vezt UTSW 10 93970547 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGTAAATTCACGCCG -3'
(R):5'- AGGAAACCATGTGCCACCAG -3'

Sequencing Primer
(F):5'- TTCACGCCGTAGCCTTATAGAGAG -3'
(R):5'- GCATGAGAGTGAGGCTAAGTCTCC -3'
Posted On2018-07-24