Incidental Mutation 'R6714:Hpx'
ID529253
Institutional Source Beutler Lab
Gene Symbol Hpx
Ensembl Gene ENSMUSG00000030895
Gene Namehemopexin
SynonymsHpxn, hx
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6714 (G1)
Quality Score208.009
Status Validated
Chromosome7
Chromosomal Location105591613-105600137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105595095 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 269 (R269C)
Ref Sequence ENSEMBL: ENSMUSP00000033185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033185] [ENSMUST00000210531]
Predicted Effect probably damaging
Transcript: ENSMUST00000033185
AA Change: R269C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895
AA Change: R269C

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000210531
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, they have increased susceptiblity to induced hemolytic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably null Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Olfr775 T A 10: 129,250,940 N135K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Hpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Hpx APN 7 105591770 missense probably damaging 1.00
IGL01861:Hpx APN 7 105592186 nonsense probably null
IGL02441:Hpx APN 7 105592223 missense probably damaging 1.00
IGL03117:Hpx APN 7 105600071 missense possibly damaging 0.94
IGL03230:Hpx APN 7 105599312 missense probably benign 0.04
IGL03376:Hpx APN 7 105592251 unclassified probably benign
IGL03392:Hpx APN 7 105592402 missense probably damaging 1.00
PIT4520001:Hpx UTSW 7 105592134 missense probably benign 0.00
R0138:Hpx UTSW 7 105592238 missense probably damaging 1.00
R0364:Hpx UTSW 7 105596264 missense probably benign 0.18
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1958:Hpx UTSW 7 105596396 missense probably damaging 1.00
R2007:Hpx UTSW 7 105595574 missense probably damaging 1.00
R2025:Hpx UTSW 7 105595104 missense probably damaging 1.00
R2173:Hpx UTSW 7 105592083 missense probably benign 0.01
R2207:Hpx UTSW 7 105592426 missense probably damaging 1.00
R3162:Hpx UTSW 7 105599640 intron probably benign
R3849:Hpx UTSW 7 105596291 missense probably damaging 1.00
R4206:Hpx UTSW 7 105595147 missense probably null 0.01
R4510:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4511:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4709:Hpx UTSW 7 105600036 missense probably benign 0.05
R5029:Hpx UTSW 7 105591764 missense probably damaging 1.00
R5540:Hpx UTSW 7 105591912 missense possibly damaging 0.67
R5631:Hpx UTSW 7 105595601 missense probably damaging 0.96
R5664:Hpx UTSW 7 105595148 missense probably benign 0.02
R5820:Hpx UTSW 7 105591788 missense possibly damaging 0.89
R5922:Hpx UTSW 7 105595624 missense probably damaging 1.00
R6707:Hpx UTSW 7 105595475 missense probably benign 0.09
X0066:Hpx UTSW 7 105596387 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGTTGGACTATGAACCTGAGG -3'
(R):5'- AGGAGAAGCCCACATTCCTC -3'

Sequencing Primer
(F):5'- TTGGACTATGAACCTGAGGAGATG -3'
(R):5'- CTCCTACCCAGTGTGTGTGTG -3'
Posted On2018-07-24