Incidental Mutation 'R6799:Lpin1'
ID533224
Institutional Source Beutler Lab
Gene Symbol Lpin1
Ensembl Gene ENSMUSG00000020593
Gene Namelipin 1
SynonymsLipin1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R6799 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location16535669-16610966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16561044 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 516 (N516Y)
Ref Sequence ENSEMBL: ENSMUSP00000152276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]
Predicted Effect probably damaging
Transcript: ENSMUST00000067124
AA Change: N549Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: N549Y

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 1.1e-48 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:Lipin_mid 498 591 9.4e-36 PFAM
low complexity region 630 642 N/A INTRINSIC
LNS2 708 864 3.42e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111067
AA Change: N549Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: N549Y

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
LNS2 675 831 3.42e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221230
AA Change: N516Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000221297
AA Change: N549Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000222989
AA Change: N516Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A T 5: 145,044,814 Y153F probably damaging Het
5830473C10Rik A G 5: 90,579,615 H364R probably damaging Het
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Anapc1 C G 2: 128,659,737 R795T probably null Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Arhgap26 A G 18: 39,099,607 N96D probably damaging Het
Asxl3 G T 18: 22,465,400 E191* probably null Het
Cc2d2b A G 19: 40,791,208 E697G possibly damaging Het
Chaf1a A T 17: 56,047,059 I110F unknown Het
Clca4b A T 3: 144,915,627 probably null Het
Dagla C A 19: 10,256,850 V366L probably damaging Het
Dapk1 A G 13: 60,752,235 N878S probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dhx38 A G 8: 109,553,202 L952P probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Dtymk A G 1: 93,798,492 L15P probably benign Het
E330034G19Rik A G 14: 24,296,110 M30V probably benign Het
Egfr G A 11: 16,896,952 C783Y probably damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fbxw24 T A 9: 109,624,930 R49S probably damaging Het
Fuk T C 8: 110,893,418 M276V probably benign Het
Gm8797 A T 3: 5,750,967 T22S probably benign Het
Hao1 T C 2: 134,530,765 S108G probably damaging Het
Hdac4 C A 1: 92,002,213 A184S probably damaging Het
Hikeshi T A 7: 89,930,345 probably benign Het
Hivep2 C T 10: 14,129,013 R452C probably benign Het
Hsdl1 T C 8: 119,566,430 S68G probably benign Het
Kctd20 T C 17: 28,963,377 probably null Het
Klf11 T C 12: 24,655,639 V364A possibly damaging Het
Kpna6 A G 4: 129,657,454 L86P probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp2 T C 2: 69,483,904 Y2161C probably damaging Het
Lrrtm3 A T 10: 64,087,851 C512* probably null Het
Mfsd1 T C 3: 67,599,981 I405T probably damaging Het
Msc T G 1: 14,755,267 D161A probably damaging Het
Mttp T C 3: 138,095,080 I755V probably benign Het
Ncam1 T C 9: 49,508,611 T803A probably damaging Het
Nlrp14 A G 7: 107,196,139 I210V probably benign Het
Npat A T 9: 53,551,630 H108L probably benign Het
Nt5dc1 A G 10: 34,313,707 I329T possibly damaging Het
Olfr1417 T A 19: 11,828,814 I71F possibly damaging Het
Olfr638 T A 7: 103,998,799 probably null Het
Olfr881 T C 9: 37,993,182 L230P possibly damaging Het
Parm1 C T 5: 91,594,211 T146I possibly damaging Het
Parp2 T C 14: 50,821,096 Y528H probably damaging Het
Pias1 G T 9: 62,882,052 S624R probably benign Het
Ppif A G 14: 25,696,064 H95R probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Psg20 A G 7: 18,684,420 Y141H probably benign Het
Pygm A T 19: 6,398,127 Y733F probably damaging Het
Rcc1l A T 5: 134,176,713 M1K probably null Het
Rfpl4b T C 10: 38,821,345 K87E possibly damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Scn5a A C 9: 119,495,622 I1380S possibly damaging Het
Sel1l A G 12: 91,814,968 probably null Het
Slc18a1 T A 8: 69,040,981 I400L probably benign Het
Slc30a3 A G 5: 31,089,614 S73P probably damaging Het
Slc9a5 A T 8: 105,363,968 N685I possibly damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trdmt1 A G 2: 13,516,013 probably null Het
Ttyh1 G T 7: 4,133,222 probably null Het
Tyms A T 5: 30,061,071 D283E probably benign Het
Vmn2r110 T A 17: 20,583,536 Y259F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r88 C A 14: 51,413,969 Q255K probably benign Het
Vmn2r95 C T 17: 18,439,293 P100S probably damaging Het
Zfp128 A T 7: 12,890,899 H398L possibly damaging Het
Other mutations in Lpin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Lpin1 APN 12 16553992 missense probably benign 0.00
IGL00929:Lpin1 APN 12 16573699 missense probably benign 0.05
IGL01485:Lpin1 APN 12 16562357 splice site probably benign
IGL01750:Lpin1 APN 12 16577176 missense probably benign 0.00
IGL01774:Lpin1 APN 12 16558476 missense probably damaging 0.96
IGL02197:Lpin1 APN 12 16558407 critical splice donor site probably null
IGL02244:Lpin1 APN 12 16541769 missense probably damaging 0.99
IGL02272:Lpin1 APN 12 16547600 missense probably damaging 1.00
IGL03366:Lpin1 APN 12 16544677 missense probably damaging 1.00
lipin UTSW 12 16547499 missense probably damaging 1.00
R0044:Lpin1 UTSW 12 16568529 splice site probably benign
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0676:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R1119:Lpin1 UTSW 12 16563721 missense probably damaging 1.00
R1570:Lpin1 UTSW 12 16560998 missense possibly damaging 0.94
R1611:Lpin1 UTSW 12 16577218 missense probably null 0.64
R1646:Lpin1 UTSW 12 16573658 critical splice donor site probably null
R1756:Lpin1 UTSW 12 16538540 missense probably damaging 0.99
R1870:Lpin1 UTSW 12 16541743 missense probably damaging 1.00
R1912:Lpin1 UTSW 12 16546727 missense probably damaging 0.96
R1971:Lpin1 UTSW 12 16580723 missense probably damaging 1.00
R2484:Lpin1 UTSW 12 16547499 missense probably damaging 1.00
R2901:Lpin1 UTSW 12 16553998 missense probably benign
R3195:Lpin1 UTSW 12 16565583 missense possibly damaging 0.91
R3779:Lpin1 UTSW 12 16564568 missense probably damaging 0.96
R3918:Lpin1 UTSW 12 16571189 missense probably benign 0.00
R4532:Lpin1 UTSW 12 16553962 missense probably benign 0.01
R4857:Lpin1 UTSW 12 16563630 missense possibly damaging 0.86
R4882:Lpin1 UTSW 12 16538536 missense probably damaging 1.00
R5024:Lpin1 UTSW 12 16554006 missense probably benign 0.38
R5084:Lpin1 UTSW 12 16576982 missense probably damaging 1.00
R5108:Lpin1 UTSW 12 16573715 missense probably benign 0.39
R5191:Lpin1 UTSW 12 16580828 missense possibly damaging 0.95
R5377:Lpin1 UTSW 12 16563655 missense probably damaging 1.00
R5587:Lpin1 UTSW 12 16573714 missense probably damaging 1.00
R5659:Lpin1 UTSW 12 16540989 missense probably damaging 1.00
R5924:Lpin1 UTSW 12 16544657 missense possibly damaging 0.91
R6391:Lpin1 UTSW 12 16564553 missense probably benign 0.29
R6746:Lpin1 UTSW 12 16565528 missense probably benign
R6969:Lpin1 UTSW 12 16580861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGGAACTCCTGAGCATCAAG -3'
(R):5'- TGGCATGTCTGTCTGTCCAC -3'

Sequencing Primer
(F):5'- AGACACCATGGCCTCAGGTTTC -3'
(R):5'- TGATCCTCCACCCTCACCATAG -3'
Posted On2018-09-12