Incidental Mutation 'R6855:Ppp5c'
ID535201
Institutional Source Beutler Lab
Gene Symbol Ppp5c
Ensembl Gene ENSMUSG00000003099
Gene Nameprotein phosphatase 5, catalytic subunit
SynonymsANP receptor, PP5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6855 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17004640-17027924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 17006966 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 359 (D359A)
Ref Sequence ENSEMBL: ENSMUSP00000003183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003183
AA Change: D359A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003183
Gene: ENSMUSG00000003099
AA Change: D359A

DomainStartEndE-ValueType
TPR 28 61 1.92e-6 SMART
TPR 62 95 8.29e0 SMART
TPR 96 129 4.28e-4 SMART
PP2Ac 204 480 2.8e-164 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122783
Gene: ENSMUSG00000003099
AA Change: D335A

DomainStartEndE-ValueType
TPR 27 60 1.92e-6 SMART
TPR 61 94 8.29e0 SMART
TPR 95 128 4.28e-4 SMART
PP2Ac 203 457 1.83e-145 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in cell cycle check-point arrest following treatment with ionizing radition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,114,845 S228F probably damaging Het
Cdh23 A T 10: 60,306,122 M3062K possibly damaging Het
Cdh8 G C 8: 99,190,217 S422C probably damaging Het
Col15a1 G T 4: 47,245,544 K98N probably damaging Het
Cyp3a57 T A 5: 145,372,566 L238H probably damaging Het
Dchs2 G A 3: 83,348,194 R2399H probably benign Het
Dennd4c A C 4: 86,836,457 H1568P probably benign Het
Dkk2 T G 3: 132,177,922 C194W probably damaging Het
Dnm2 C T 9: 21,476,585 R369C probably damaging Het
Efcab7 T G 4: 99,900,580 L308* probably null Het
Elp2 T A 18: 24,606,877 N53K possibly damaging Het
Eml6 T C 11: 29,751,381 probably null Het
Erich3 G T 3: 154,762,649 E913* probably null Het
Fam159b T C 13: 104,863,706 Q3R probably benign Het
Fam186a T A 15: 99,954,875 Y154F unknown Het
Fhl3 G A 4: 124,707,522 D113N probably benign Het
Fryl A T 5: 73,059,500 M2149K probably damaging Het
Gbf1 T C 19: 46,279,941 Y1251H probably benign Het
Ghitm C A 14: 37,125,902 G262W probably null Het
Gm14325 T A 2: 177,832,842 H148L probably damaging Het
Grxcr1 C A 5: 68,032,094 N69K possibly damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdelc1 C A 1: 44,110,827 E401* probably null Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrp1b G C 2: 40,628,696 H175D possibly damaging Het
Lrrc2 T A 9: 110,953,182 probably null Het
Mpp3 A G 11: 102,013,325 F291L probably benign Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Nfil3 T A 13: 52,968,605 K88* probably null Het
Nit1 A C 1: 171,343,562 V194G probably damaging Het
Nup210 T C 6: 91,040,853 M1052V probably benign Het
Nup210l A G 3: 90,136,924 T511A probably benign Het
Nwd2 G T 5: 63,804,451 M459I probably benign Het
Olfr1077-ps1 T C 2: 86,526,169 N3D probably benign Het
Peg3 A C 7: 6,708,798 S1142A probably benign Het
Phf3 T A 1: 30,820,123 K959N probably damaging Het
Piezo2 C T 18: 63,090,879 probably null Het
Pigz A G 16: 31,945,218 I365V possibly damaging Het
Plec T A 15: 76,186,618 Q860L probably damaging Het
Pvr C T 7: 19,909,214 A365T possibly damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rasa3 A T 8: 13,585,029 L430Q probably damaging Het
Rims2 T G 15: 39,345,515 V198G probably benign Het
Rnf38 C T 4: 44,149,224 R41H probably damaging Het
Rptn G A 3: 93,398,251 V964I probably benign Het
Rrp1b A G 17: 32,052,745 D263G probably benign Het
Sgip1 T C 4: 102,962,376 C560R probably damaging Het
Sidt1 A C 16: 44,245,343 I734S probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Ssh1 G T 5: 113,942,575 D931E probably damaging Het
Thumpd2 C A 17: 81,044,170 R274I probably damaging Het
Tpi1 T C 6: 124,812,463 D183G probably damaging Het
Trnt1 T A 6: 106,777,922 Y205N probably damaging Het
Tsc22d2 G A 3: 58,416,814 V376M probably damaging Het
Usp34 T C 11: 23,452,569 V2454A possibly damaging Het
Uspl1 C A 5: 149,187,845 S24Y probably damaging Het
Vmn1r58 A C 7: 5,410,452 W260G possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zfp868 A C 8: 69,611,579 H368Q probably damaging Het
Other mutations in Ppp5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Ppp5c APN 7 17008630 missense possibly damaging 0.87
IGL02794:Ppp5c APN 7 17006960 missense probably benign 0.15
IGL02831:Ppp5c APN 7 17008645 missense probably damaging 1.00
IGL02950:Ppp5c APN 7 17006910 missense probably benign 0.00
Persephone UTSW 7 17022443 missense probably benign 0.01
R0078:Ppp5c UTSW 7 17027725 missense probably benign 0.09
R0366:Ppp5c UTSW 7 17022583 nonsense probably null
R1102:Ppp5c UTSW 7 17022443 missense probably benign 0.01
R1511:Ppp5c UTSW 7 17009982 missense probably damaging 1.00
R1518:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R1714:Ppp5c UTSW 7 17008703 missense probably benign 0.01
R1754:Ppp5c UTSW 7 17005310 missense probably benign 0.20
R2380:Ppp5c UTSW 7 17006115 missense probably damaging 1.00
R2431:Ppp5c UTSW 7 17015425 missense probably damaging 0.99
R4854:Ppp5c UTSW 7 17009022 missense probably benign 0.00
R4974:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R5303:Ppp5c UTSW 7 17005284 missense probably benign
R5626:Ppp5c UTSW 7 17027704 missense probably benign
R5785:Ppp5c UTSW 7 17027691 critical splice donor site probably null
R6059:Ppp5c UTSW 7 17027907 unclassified probably benign
X0026:Ppp5c UTSW 7 17007110 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCCCAGAGTTCATTTCACC -3'
(R):5'- ACACAGCCCAGATGTATGAGC -3'

Sequencing Primer
(F):5'- AGAGTTCATTTCACCCACATCATC -3'
(R):5'- AGCCCAGATGTATGAGCTCTTCAG -3'
Posted On2018-09-12