Incidental Mutation 'R6861:Peg3'
ID535522
Institutional Source Beutler Lab
Gene Symbol Peg3
Ensembl Gene ENSMUSG00000002265
Gene Namepaternally expressed 3
SynonymsZfp102, Gcap4, Pw1, End4
MMRRC Submission
Accession Numbers

Genbank: NM_008817; MGI: 104748

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6861 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6703892-6730431 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 6711386 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 279 (S279*)
Ref Sequence ENSEMBL: ENSMUSP00000050750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051209] [ENSMUST00000143703] [ENSMUST00000150182]
Predicted Effect probably null
Transcript: ENSMUST00000051209
AA Change: S279*
SMART Domains Protein: ENSMUSP00000050750
Gene: ENSMUSG00000002265
AA Change: S279*

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
ZnF_C2H2 325 347 7.26e-3 SMART
ZnF_C2H2 378 400 6.88e-4 SMART
ZnF_C2H2 436 458 2.95e-3 SMART
low complexity region 464 496 N/A INTRINSIC
ZnF_C2H2 520 542 5.99e-4 SMART
low complexity region 691 698 N/A INTRINSIC
ZnF_C2H2 850 872 2.99e-4 SMART
ZnF_C2H2 1091 1113 2.05e-2 SMART
ZnF_C2H2 1147 1169 1.04e-3 SMART
ZnF_C2H2 1209 1231 1.38e-3 SMART
ZnF_C2H2 1266 1289 1.89e-1 SMART
ZnF_C2H2 1317 1339 1.57e2 SMART
low complexity region 1373 1419 N/A INTRINSIC
low complexity region 1440 1486 N/A INTRINSIC
ZnF_C2H2 1488 1510 2.2e-2 SMART
ZnF_C2H2 1547 1569 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143703
SMART Domains Protein: ENSMUSP00000122423
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150182
SMART Domains Protein: ENSMUSP00000116161
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous mutant females exhibit growth retardation, impaired maternal behavior and diminished milk ejection, and fewer oxytocin neurons. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,743,675 H32R probably damaging Het
Adamtsl4 G A 3: 95,680,884 R598C probably damaging Het
Adra2a T C 19: 54,046,387 L58P probably damaging Het
Alox5ap A G 5: 149,265,117 D2G probably damaging Het
Arid1b G A 17: 5,327,686 V1238M possibly damaging Het
Bank1 A G 3: 136,255,003 V31A probably benign Het
Bptf G A 11: 107,062,565 T2117M probably damaging Het
Cadps G A 14: 12,522,401 R588* probably null Het
Cavin4 A G 4: 48,672,214 I220V probably benign Het
Cep192 G A 18: 67,841,628 M1267I probably benign Het
Cers5 G A 15: 99,772,363 probably benign Het
Cfap65 A T 1: 74,925,115 I558N probably damaging Het
Cfh A T 1: 140,100,883 S1025T probably benign Het
Cftr A G 6: 18,268,108 I689V probably benign Het
Cgrrf1 T C 14: 46,832,328 I18T probably damaging Het
CK137956 A G 4: 127,970,726 S37P probably damaging Het
Clca4a T C 3: 144,970,655 D88G probably benign Het
Col11a1 G A 3: 114,167,492 G1166D probably damaging Het
Col24a1 G A 3: 145,460,834 G1075S probably damaging Het
Crispld2 C T 8: 120,026,113 T299M probably damaging Het
Cyb561a3 T A 19: 10,585,337 Y114N probably damaging Het
Cyp3a57 T A 5: 145,370,963 W147R possibly damaging Het
Dnah2 C A 11: 69,455,963 R2599L possibly damaging Het
Dock1 T A 7: 134,771,478 S525T probably benign Het
Drc7 T G 8: 95,062,397 probably null Het
Efhd2 G T 4: 141,859,881 probably null Het
Epb41l1 A T 2: 156,525,222 E658D probably benign Het
Evi5 C T 5: 107,748,318 S753N probably benign Het
Exoc3 A T 13: 74,189,200 D427E probably benign Het
Fbxw9 A G 8: 85,066,111 D363G probably damaging Het
Fcer2a T C 8: 3,682,910 Y277C probably damaging Het
Fstl5 A T 3: 76,322,216 Y108F probably damaging Het
Gcn1l1 A G 5: 115,611,049 D1880G probably benign Het
Gm4924 T A 10: 82,379,114 Y915* probably null Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Gpr139 T A 7: 119,144,652 I237F probably benign Het
Hao2 A G 3: 98,877,182 L289S probably damaging Het
Hexim1 A G 11: 103,116,967 S16G probably benign Het
Hmgcs1 T A 13: 119,699,999 M109K probably damaging Het
Hs3st4 T A 7: 124,396,829 N239K possibly damaging Het
Hsd3b5 T A 3: 98,622,012 N101Y probably damaging Het
Idh2 G A 7: 80,098,218 P245S probably damaging Het
Irx3 A G 8: 91,798,902 probably benign Het
Lilra5 A T 7: 4,241,932 D234V probably benign Het
Lrfn5 G A 12: 61,839,690 S88N probably damaging Het
Lrp2 A T 2: 69,513,377 S879R possibly damaging Het
Lsm11 A G 11: 45,933,954 S249P probably benign Het
Ltbp1 C T 17: 75,227,192 A543V possibly damaging Het
Mbd1 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,574 Het
Mier2 C T 10: 79,541,156 probably benign Het
Mup6 G C 4: 60,004,093 G70A probably benign Het
Neb A G 2: 52,195,720 L5258P probably damaging Het
Nlrc5 G A 8: 94,521,229 probably benign Het
Nr6a1 A T 2: 38,740,585 F207I possibly damaging Het
Olfr1385 A T 11: 49,494,805 T91S probably benign Het
Olfr181 A T 16: 58,926,504 D22E probably benign Het
Olfr902 T C 9: 38,449,435 C188R probably damaging Het
Osbp2 A G 11: 3,715,191 V51A possibly damaging Het
Papln G T 12: 83,774,949 C317F probably damaging Het
Pdcd7 T C 9: 65,358,622 S454P probably damaging Het
Pde4a C T 9: 21,205,301 T473I probably damaging Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Rbl1 A G 2: 157,152,967 Y929H probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sall3 C A 18: 80,974,375 E113* probably null Het
Scn5a A C 9: 119,530,023 F653V probably damaging Het
Selenok T A 14: 29,970,048 N14K possibly damaging Het
Slc22a20 T C 19: 5,971,810 T426A probably benign Het
Slc4a2 T A 5: 24,435,009 S563T probably damaging Het
Sspo T A 6: 48,487,955 S3798T probably benign Het
Stag3 G T 5: 138,304,707 R63L possibly damaging Het
Stard9 A T 2: 120,705,186 M3975L probably benign Het
Syne2 C A 12: 75,909,266 T582K probably damaging Het
Synj1 G A 16: 90,963,880 Q748* probably null Het
Tas2r109 T C 6: 132,980,085 D294G probably benign Het
Tbl1xr1 C T 3: 22,191,439 T203M possibly damaging Het
Tbl1xr1 T A 3: 22,191,539 probably null Het
Tcf7l2 A G 19: 55,742,523 D19G probably damaging Het
Tecta A G 9: 42,337,337 V1923A possibly damaging Het
Tg T A 15: 66,688,891 M1034K probably benign Het
Ttf2 T C 3: 100,969,625 E8G possibly damaging Het
Vps13b T A 15: 35,576,395 V983E probably damaging Het
Vwa2 T C 19: 56,901,593 V210A probably benign Het
Xkr6 T A 14: 63,819,644 Y335N probably benign Het
Zfp97 A G 17: 17,145,175 H312R probably damaging Het
Other mutations in Peg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Peg3 APN 7 6710274 missense probably benign 0.09
IGL01410:Peg3 APN 7 6707625 missense probably benign 0.04
IGL01415:Peg3 APN 7 6711653 missense probably damaging 0.99
IGL02073:Peg3 APN 7 6711002 missense probably damaging 1.00
IGL02193:Peg3 APN 7 6711928 missense probably damaging 1.00
IGL02212:Peg3 APN 7 6711416 missense probably benign 0.41
IGL02215:Peg3 APN 7 6709011 missense probably benign 0.00
IGL02407:Peg3 APN 7 6707636 missense probably damaging 0.99
IGL02586:Peg3 APN 7 6710069 missense probably benign
IGL02673:Peg3 APN 7 6710414 missense probably damaging 1.00
IGL02935:Peg3 APN 7 6711129 missense probably damaging 1.00
IGL03277:Peg3 APN 7 6711674 missense probably damaging 1.00
IGL03330:Peg3 APN 7 6710413 missense probably damaging 1.00
IGL03393:Peg3 APN 7 6707649 missense probably damaging 0.99
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0518:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R0521:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R1477:Peg3 UTSW 7 6716142 missense probably damaging 1.00
R1716:Peg3 UTSW 7 6707781 missense possibly damaging 0.93
R1721:Peg3 UTSW 7 6709901 missense possibly damaging 0.92
R1732:Peg3 UTSW 7 6709085 missense possibly damaging 0.72
R2051:Peg3 UTSW 7 6712721 missense probably damaging 0.96
R2288:Peg3 UTSW 7 6709115 missense probably damaging 0.96
R3606:Peg3 UTSW 7 6708509 missense probably damaging 1.00
R5075:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5076:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5084:Peg3 UTSW 7 6707849 missense probably damaging 1.00
R5097:Peg3 UTSW 7 6710027 missense probably damaging 0.99
R5121:Peg3 UTSW 7 6710289 missense probably benign 0.20
R5141:Peg3 UTSW 7 6709382 missense probably benign 0.03
R5292:Peg3 UTSW 7 6708260 missense probably damaging 1.00
R5294:Peg3 UTSW 7 6717849 missense possibly damaging 0.88
R5342:Peg3 UTSW 7 6709970 missense probably damaging 1.00
R5415:Peg3 UTSW 7 6708629 missense probably benign
R5906:Peg3 UTSW 7 6717855 missense probably damaging 0.99
R6056:Peg3 UTSW 7 6709571 missense probably damaging 1.00
R6259:Peg3 UTSW 7 6709811 missense probably damaging 0.99
R6529:Peg3 UTSW 7 6708072 missense probably damaging 1.00
R6631:Peg3 UTSW 7 6709070 missense possibly damaging 0.72
R6855:Peg3 UTSW 7 6708798 missense probably benign 0.13
R6864:Peg3 UTSW 7 6712762 missense probably damaging 1.00
R6892:Peg3 UTSW 7 6708899 missense possibly damaging 0.58
R7018:Peg3 UTSW 7 6708839 missense possibly damaging 0.72
R7039:Peg3 UTSW 7 6717859 missense probably damaging 0.99
R7066:Peg3 UTSW 7 6708857 missense probably damaging 1.00
R7117:Peg3 UTSW 7 6709168 unclassified probably benign
R7133:Peg3 UTSW 7 6708945 missense probably damaging 1.00
YA93:Peg3 UTSW 7 6711647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTAGTGTGCATGATCTGG -3'
(R):5'- GGTTCCCCAGGCCTAATGATAAC -3'

Sequencing Primer
(F):5'- TGATCTGGTGCTCAACAAACTCAG -3'
(R):5'- CCCAGGCCTAATGATAACTGGAAG -3'
Posted On2018-09-12