Incidental Mutation 'R6906:Prl8a2'
ID538795
Institutional Source Beutler Lab
Gene Symbol Prl8a2
Ensembl Gene ENSMUSG00000018259
Gene Nameprolactin family 8, subfamily a, member 2
SynonymsDPRP, Dtprp, D/tPRP, mdPRP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6906 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location27345673-27354216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27348917 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 37 (N37K)
Ref Sequence ENSEMBL: ENSMUSP00000105992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018403] [ENSMUST00000110363]
Predicted Effect probably benign
Transcript: ENSMUST00000018403
AA Change: N38K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000018403
Gene: ENSMUSG00000018259
AA Change: N38K

DomainStartEndE-ValueType
Pfam:Hormone_1 16 240 6.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110363
AA Change: N37K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105992
Gene: ENSMUSG00000018259
AA Change: N37K

DomainStartEndE-ValueType
Pfam:Hormone_1 15 239 2.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223918
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced pregnancy success when exposed to hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 A G 5: 24,568,842 F350L possibly damaging Het
Ahnak2 T A 12: 112,785,313 T305S probably benign Het
Anp32a A G 9: 62,377,569 probably benign Het
Aplf A G 6: 87,630,086 S449P possibly damaging Het
Arl6ip4 A G 5: 124,116,551 R36G possibly damaging Het
Ascc1 G A 10: 60,004,852 D12N probably benign Het
Bin1 C A 18: 32,421,925 H243Q probably benign Het
Ccdc7a C A 8: 128,935,681 V547L unknown Het
Cntnap5c T A 17: 58,395,307 N1207K probably benign Het
Coro7 C A 16: 4,633,304 R507L probably benign Het
Crtap T A 9: 114,381,632 K291N probably benign Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Dmrta1 A G 4: 89,691,966 T388A probably benign Het
Ehd3 T C 17: 73,830,338 F501L probably damaging Het
Fam126a A T 5: 23,999,958 W12R probably damaging Het
Fam160a2 G A 7: 105,388,269 T369I probably damaging Het
Fbn2 A C 18: 58,071,819 L1184R possibly damaging Het
Gm8251 C T 1: 44,056,013 S1975N probably benign Het
Hsf1 T C 15: 76,477,719 probably null Het
Kansl1l T C 1: 66,723,278 H810R possibly damaging Het
Lrp5 A T 19: 3,622,638 I557N probably damaging Het
Lypd1 T C 1: 125,910,459 E41G probably damaging Het
Mgam A G 6: 40,747,919 Y443C probably damaging Het
Muc2 A G 7: 141,698,733 D871G probably damaging Het
Nup85 T A 11: 115,580,943 Y198N probably damaging Het
Obscn T A 11: 59,032,918 M6578L possibly damaging Het
Olfr1097 T C 2: 86,890,747 T143A probably benign Het
Osbpl5 G C 7: 143,694,328 Q667E probably damaging Het
Ovgp1 T A 3: 105,986,873 probably benign Het
Ptprf A T 4: 118,269,277 I93N possibly damaging Het
Rnf112 T C 11: 61,450,389 S457G probably null Het
Sema3e A G 5: 14,240,587 D562G probably damaging Het
Sesn3 A G 9: 14,325,641 M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shc3 T C 13: 51,466,559 T144A probably damaging Het
Sis A G 3: 72,919,485 L1287P probably damaging Het
Srrm2 C T 17: 23,820,363 P2090S probably damaging Het
Syne2 T G 12: 75,995,986 D3910E possibly damaging Het
Tcaim C T 9: 122,834,774 T443I probably benign Het
Tex19.1 T C 11: 121,147,122 V102A probably benign Het
Tpd52l1 T G 10: 31,332,954 T168P possibly damaging Het
Trdn G A 10: 33,233,948 C294Y probably benign Het
Trmt1l T C 1: 151,452,175 Y479H probably benign Het
Vmn1r171 G A 7: 23,632,379 V10I probably benign Het
Zbtb41 T A 1: 139,423,390 D80E possibly damaging Het
Zcchc4 A G 5: 52,823,634 K473E possibly damaging Het
Other mutations in Prl8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02654:Prl8a2 APN 13 27352797 missense possibly damaging 0.56
IGL03268:Prl8a2 APN 13 27353955 missense probably benign 0.09
R0557:Prl8a2 UTSW 13 27352892 nonsense probably null
R0574:Prl8a2 UTSW 13 27348900 missense probably damaging 1.00
R1166:Prl8a2 UTSW 13 27353952 missense possibly damaging 0.53
R1401:Prl8a2 UTSW 13 27353996 missense possibly damaging 0.55
R1875:Prl8a2 UTSW 13 27351054 missense probably benign 0.02
R2420:Prl8a2 UTSW 13 27348913 missense possibly damaging 0.46
R4152:Prl8a2 UTSW 13 27351002 missense possibly damaging 0.86
R5285:Prl8a2 UTSW 13 27350133 unclassified probably null
R6452:Prl8a2 UTSW 13 27352797 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGGCAGATAAAACTTTCCTGAATC -3'
(R):5'- TCTTCCCCTAGTATCAGTAGTTGG -3'

Sequencing Primer
(F):5'- AACTTTCCTGAATCAGTTGGTTC -3'
(R):5'- CCTAGTATCAGTAGTTGGTGCCTC -3'
Posted On2018-11-06