Incidental Mutation 'R6906:Srrm2'
ID538800
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R6906 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23820363 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 2090 (P2090S)
Ref Sequence ENSEMBL: ENSMUSP00000139842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069579] [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect probably benign
Transcript: ENSMUST00000069579
SMART Domains Protein: ENSMUSP00000066210
Gene: ENSMUSG00000055839

DomainStartEndE-ValueType
UBQ 3 80 5.1e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088621
AA Change: P1994S

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: P1994S

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186259
Predicted Effect probably damaging
Transcript: ENSMUST00000190686
AA Change: P2090S

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: P2090S

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 A G 5: 24,568,842 F350L possibly damaging Het
Ahnak2 T A 12: 112,785,313 T305S probably benign Het
Anp32a A G 9: 62,377,569 probably benign Het
Aplf A G 6: 87,630,086 S449P possibly damaging Het
Arl6ip4 A G 5: 124,116,551 R36G possibly damaging Het
Ascc1 G A 10: 60,004,852 D12N probably benign Het
Bin1 C A 18: 32,421,925 H243Q probably benign Het
Ccdc7a C A 8: 128,935,681 V547L unknown Het
Cntnap5c T A 17: 58,395,307 N1207K probably benign Het
Coro7 C A 16: 4,633,304 R507L probably benign Het
Crtap T A 9: 114,381,632 K291N probably benign Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Dmrta1 A G 4: 89,691,966 T388A probably benign Het
Ehd3 T C 17: 73,830,338 F501L probably damaging Het
Fam126a A T 5: 23,999,958 W12R probably damaging Het
Fam160a2 G A 7: 105,388,269 T369I probably damaging Het
Fbn2 A C 18: 58,071,819 L1184R possibly damaging Het
Gm8251 C T 1: 44,056,013 S1975N probably benign Het
Hsf1 T C 15: 76,477,719 probably null Het
Kansl1l T C 1: 66,723,278 H810R possibly damaging Het
Lrp5 A T 19: 3,622,638 I557N probably damaging Het
Lypd1 T C 1: 125,910,459 E41G probably damaging Het
Mgam A G 6: 40,747,919 Y443C probably damaging Het
Muc2 A G 7: 141,698,733 D871G probably damaging Het
Nup85 T A 11: 115,580,943 Y198N probably damaging Het
Obscn T A 11: 59,032,918 M6578L possibly damaging Het
Olfr1097 T C 2: 86,890,747 T143A probably benign Het
Osbpl5 G C 7: 143,694,328 Q667E probably damaging Het
Ovgp1 T A 3: 105,986,873 probably benign Het
Prl8a2 T A 13: 27,348,917 N37K probably benign Het
Ptprf A T 4: 118,269,277 I93N possibly damaging Het
Rnf112 T C 11: 61,450,389 S457G probably null Het
Sema3e A G 5: 14,240,587 D562G probably damaging Het
Sesn3 A G 9: 14,325,641 M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shc3 T C 13: 51,466,559 T144A probably damaging Het
Sis A G 3: 72,919,485 L1287P probably damaging Het
Syne2 T G 12: 75,995,986 D3910E possibly damaging Het
Tcaim C T 9: 122,834,774 T443I probably benign Het
Tex19.1 T C 11: 121,147,122 V102A probably benign Het
Tpd52l1 T G 10: 31,332,954 T168P possibly damaging Het
Trdn G A 10: 33,233,948 C294Y probably benign Het
Trmt1l T C 1: 151,452,175 Y479H probably benign Het
Vmn1r171 G A 7: 23,632,379 V10I probably benign Het
Zbtb41 T A 1: 139,423,390 D80E possibly damaging Het
Zcchc4 A G 5: 52,823,634 K473E possibly damaging Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCTGCATCTGGAAGTAGTTC -3'
(R):5'- AACCTGGGACATTCTTGCAGC -3'

Sequencing Primer
(F):5'- ATCTGGAAGTAGTTCTGATCGTTCAC -3'
(R):5'- ATTCTTGCAGCAAGGCCAG -3'
Posted On2018-11-06