Mutagenetix > Incidental Mutation

Incidental Mutation 'R6906:Muc2'

538779

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

044998-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R6906 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141284976 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 871 (D871G)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185406
AA Change: D871G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: D871G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf2	A	G	5: 24,773,840 (GRCm39)	F350L	possibly damaging	Het
Ahnak2	T	A	12: 112,748,933 (GRCm39)	T305S	probably benign	Het
Anp32a	A	G	9: 62,284,851 (GRCm39)		probably benign	Het
Aplf	A	G	6: 87,607,068 (GRCm39)	S449P	possibly damaging	Het
Arl6ip4	A	G	5: 124,254,614 (GRCm39)	R36G	possibly damaging	Het
Ascc1	G	A	10: 59,840,674 (GRCm39)	D12N	probably benign	Het
Bin1	C	A	18: 32,554,978 (GRCm39)	H243Q	probably benign	Het
Ccdc168	C	T	1: 44,095,173 (GRCm39)	S1975N	probably benign	Het
Ccdc7a	C	A	8: 129,662,162 (GRCm39)	V547L	unknown	Het
Cntnap5c	T	A	17: 58,702,302 (GRCm39)	N1207K	probably benign	Het
Coro7	C	A	16: 4,451,168 (GRCm39)	R507L	probably benign	Het
Crtap	T	A	9: 114,210,700 (GRCm39)	K291N	probably benign	Het
Csmd3	T	C	15: 47,710,569 (GRCm39)	T1569A	probably benign	Het
Dmrta1	A	G	4: 89,580,203 (GRCm39)	T388A	probably benign	Het
Ehd3	T	C	17: 74,137,333 (GRCm39)	F501L	probably damaging	Het
Fbn2	A	C	18: 58,204,891 (GRCm39)	L1184R	possibly damaging	Het
Fhip1b	G	A	7: 105,037,476 (GRCm39)	T369I	probably damaging	Het
Hsf1	T	C	15: 76,361,919 (GRCm39)		probably null	Het
Hycc1	A	T	5: 24,204,956 (GRCm39)	W12R	probably damaging	Het
Kansl1l	T	C	1: 66,762,437 (GRCm39)	H810R	possibly damaging	Het
Lrp5	A	T	19: 3,672,638 (GRCm39)	I557N	probably damaging	Het
Lypd1	T	C	1: 125,838,196 (GRCm39)	E41G	probably damaging	Het
Mgam	A	G	6: 40,724,853 (GRCm39)	Y443C	probably damaging	Het
Nup85	T	A	11: 115,471,769 (GRCm39)	Y198N	probably damaging	Het
Obscn	T	A	11: 58,923,744 (GRCm39)	M6578L	possibly damaging	Het
Or8h7	T	C	2: 86,721,091 (GRCm39)	T143A	probably benign	Het
Osbpl5	G	C	7: 143,248,065 (GRCm39)	Q667E	probably damaging	Het
Ovgp1	T	A	3: 105,894,189 (GRCm39)		probably benign	Het
Prl8a2	T	A	13: 27,532,900 (GRCm39)	N37K	probably benign	Het
Ptprf	A	T	4: 118,126,474 (GRCm39)	I93N	possibly damaging	Het
Rnf112	T	C	11: 61,341,215 (GRCm39)	S457G	probably null	Het
Sema3e	A	G	5: 14,290,601 (GRCm39)	D562G	probably damaging	Het
Sesn3	A	G	9: 14,236,937 (GRCm39)	M472V	probably damaging	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 126,915,419 (GRCm39)		probably benign	Het
Shc3	T	C	13: 51,620,595 (GRCm39)	T144A	probably damaging	Het
Sis	A	G	3: 72,826,818 (GRCm39)	L1287P	probably damaging	Het
Srrm2	C	T	17: 24,039,337 (GRCm39)	P2090S	probably damaging	Het
Syne2	T	G	12: 76,042,760 (GRCm39)	D3910E	possibly damaging	Het
Tcaim	C	T	9: 122,663,839 (GRCm39)	T443I	probably benign	Het
Tex19.1	T	C	11: 121,037,948 (GRCm39)	V102A	probably benign	Het
Tpd52l1	T	G	10: 31,208,950 (GRCm39)	T168P	possibly damaging	Het
Trdn	G	A	10: 33,109,944 (GRCm39)	C294Y	probably benign	Het
Trmt1l	T	C	1: 151,327,926 (GRCm39)	Y479H	probably benign	Het
Vmn1r171	G	A	7: 23,331,804 (GRCm39)	V10I	probably benign	Het
Zbtb41	T	A	1: 139,351,128 (GRCm39)	D80E	possibly damaging	Het
Zcchc4	A	G	5: 52,980,976 (GRCm39)	K473E	possibly damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141,305,151 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141,305,214 (GRCm39)	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141,306,432 (GRCm39)	missense	possibly damaging	0.48
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141,308,173 (GRCm39)	missense
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8701:Muc2	UTSW	7	141,281,850 (GRCm39)	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141,287,453 (GRCm39)	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- GGCCAGTATACATGCTTGCAGG -3'
(R):5'- ACCCAAATCCTAGCAGTGTG -3'

Sequencing Primer
(F):5'- AGGTATCTCCATGGCATCCAG -3'
(R):5'- CAAATCCTAGCAGTGTGTGGGTTC -3'

Posted On

2018-11-06