Incidental Mutation 'R6963:Ggn'
ID543329
Institutional Source Beutler Lab
Gene Symbol Ggn
Ensembl Gene ENSMUSG00000031493
Gene Namegametogenetin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6963 (G1)
Quality Score221.009
Status Validated
Chromosome7
Chromosomal Location29170210-29173976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29171582 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 142 (E142G)
Ref Sequence ENSEMBL: ENSMUSP00000146620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033886] [ENSMUST00000048923] [ENSMUST00000059642] [ENSMUST00000098609] [ENSMUST00000182328] [ENSMUST00000186182] [ENSMUST00000208288] [ENSMUST00000208330] [ENSMUST00000209019] [ENSMUST00000209034]
Predicted Effect probably benign
Transcript: ENSMUST00000033886
SMART Domains Protein: ENSMUSP00000033886
Gene: ENSMUSG00000031493

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059642
SMART Domains Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
Pfam:CSN8_PSD8_EIF3K 189 330 1.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098609
AA Change: E165G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096209
Gene: ENSMUSG00000031493
AA Change: E165G

DomainStartEndE-ValueType
Pfam:GGN 38 342 2.1e-158 PFAM
Pfam:GGN 340 709 1.5e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182328
SMART Domains Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:SAC3_GANP 49 232 1.2e-37 PFAM
Pfam:PCI_Csn8 125 266 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186182
SMART Domains Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
Pfam:SAC3_GANP 113 296 1.3e-37 PFAM
Pfam:PCI_Csn8 189 330 2.3e-42 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000208288
AA Change: E165G
Predicted Effect probably damaging
Transcript: ENSMUST00000208330
AA Change: E142G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000209019
AA Change: E129G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000209034
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a germ cell-specific gene that encodes proteins that interact with POG (proliferation of germ cells). Alternatively spliced transcript variants of a similar mouse gene encode at least three different proteins, namely gametogenetin protein 1a, gametogenetin protein 2, and gametogenetin protein 3, which show a perinuclear, cytoplasmic, and nucleolar localization, respectively. These proteins regulate the localization of POG and may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for this allele exhibit impaired double-strand break repair in spermatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Vps50 T C 6: 3,592,577 probably null Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Ggn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0302:Ggn UTSW 7 29171240 unclassified probably null
R0317:Ggn UTSW 7 29171090 start codon destroyed probably null
R0376:Ggn UTSW 7 29173022 missense possibly damaging 0.51
R0469:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0581:Ggn UTSW 7 29172304 missense probably benign 0.40
R1375:Ggn UTSW 7 29171941 missense probably damaging 0.97
R1956:Ggn UTSW 7 29171916 missense probably damaging 0.99
R2012:Ggn UTSW 7 29173763 unclassified probably null
R4436:Ggn UTSW 7 29171551 missense probably damaging 0.98
R4444:Ggn UTSW 7 29172160 missense probably benign 0.06
R4977:Ggn UTSW 7 29172196 missense probably damaging 1.00
R5762:Ggn UTSW 7 29172352 missense probably damaging 0.98
R5822:Ggn UTSW 7 29172556 missense probably damaging 0.97
R6180:Ggn UTSW 7 29173049 missense probably damaging 0.98
R6294:Ggn UTSW 7 29173848 missense possibly damaging 0.92
R6667:Ggn UTSW 7 29172668 missense possibly damaging 0.71
R7084:Ggn UTSW 7 29172998 missense probably damaging 0.97
R7242:Ggn UTSW 7 29173034 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTCCAAGAACAGCCTGAGC -3'
(R):5'- AGAGTGATTCTGCGGCTCAG -3'

Sequencing Primer
(F):5'- CGACCTTCTTCAAAAATGGGG -3'
(R):5'- CTCAGGGGCTGCGGATC -3'
Posted On2018-11-28