Incidental Mutation 'R7046:Chsy3'
ID547348
Institutional Source Beutler Lab
Gene Symbol Chsy3
Ensembl Gene ENSMUSG00000058152
Gene Namechondroitin sulfate synthase 3
Synonyms4833446K15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001081328.1; MGI:1926173

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7046 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location59175401-59410446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59409803 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 671 (K671R)
Ref Sequence ENSEMBL: ENSMUSP00000079546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080721]
Predicted Effect probably benign
Transcript: ENSMUST00000080721
AA Change: K671R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079546
Gene: ENSMUSG00000058152
AA Change: K671R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Pfam:Fringe 169 410 9.4e-19 PFAM
Pfam:CHGN 330 866 1.4e-194 PFAM
Pfam:Glyco_tranf_2_2 652 841 1.8e-7 PFAM
Pfam:Glyco_transf_7C 769 839 3.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,122,940 Y805C probably damaging Het
Cabp7 T A 11: 4,738,886 I195F probably damaging Het
Camsap1 T C 2: 25,945,189 N317S probably damaging Het
Ccdc127 T G 13: 74,352,875 L4V probably damaging Het
Ccdc7a T C 8: 129,047,619 E145G probably damaging Het
Cdh10 T A 15: 19,013,201 V629D probably damaging Het
Cdh23 A C 10: 60,378,751 L1497R probably damaging Het
Clca4b T C 3: 144,915,606 Y569C probably damaging Het
Cnga1 T C 5: 72,629,353 probably benign Het
Cyp51 T A 5: 4,100,188 E178D probably damaging Het
Defa30 T A 8: 21,135,455 N78K probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnah14 G T 1: 181,623,003 C727F probably benign Het
Egf A T 3: 129,754,958 W3R unknown Het
Egfem1 G A 3: 29,082,215 probably null Het
Epb41l1 G T 2: 156,526,892 V682L possibly damaging Het
Etv1 A G 12: 38,784,370 probably null Het
Faap100 A G 11: 120,377,374 F191S possibly damaging Het
Fam208a A T 14: 27,472,435 L1197F probably damaging Het
Fmo1 T A 1: 162,839,694 D184V possibly damaging Het
Ghrl A G 6: 113,719,383 L16P probably damaging Het
Gria4 T A 9: 4,420,278 L861F probably damaging Het
Gsr T A 8: 33,695,062 M428K probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kbtbd12 A G 6: 88,618,515 M111T possibly damaging Het
Krtap21-1 G T 16: 89,403,735 Y6* probably null Het
Lin9 A G 1: 180,667,370 D219G probably damaging Het
Lrrc38 A G 4: 143,350,169 M1V probably null Het
Macc1 T G 12: 119,447,038 F514V probably benign Het
Madcam1 C T 10: 79,668,305 R242C probably benign Het
Mfhas1 T C 8: 35,664,790 S1037P probably benign Het
Micall2 C T 5: 139,708,944 probably benign Het
Mtr C A 13: 12,190,209 A1122S possibly damaging Het
Muc6 T A 7: 141,640,189 probably benign Het
Myh15 T A 16: 49,109,299 C529* probably null Het
Napsa T C 7: 44,585,085 V247A probably damaging Het
Nr2c2 A G 6: 92,158,357 T309A probably damaging Het
Olfr133 A T 17: 38,148,800 M71L probably benign Het
Olfr357 T A 2: 36,997,161 V117E probably benign Het
Olfr385 A T 11: 73,589,732 I2K probably benign Het
Osgepl1 A T 1: 53,321,551 I384F possibly damaging Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pds5b A G 5: 150,749,920 Y481C probably damaging Het
Pdzrn4 T A 15: 92,770,422 Y818* probably null Het
Pin1rt1 T C 2: 104,714,422 S122G probably benign Het
Pkdcc A T 17: 83,224,258 Y487F probably damaging Het
Plxna4 C T 6: 32,516,505 C392Y probably damaging Het
Psd4 T G 2: 24,394,973 M283R probably benign Het
Ralgds G T 2: 28,540,729 G68W probably damaging Het
Rmdn2 T A 17: 79,621,379 I20N probably damaging Het
Sestd1 A G 2: 77,192,566 V486A probably benign Het
Svs1 T A 6: 48,987,578 D173E probably benign Het
Tango6 A G 8: 106,807,116 H958R possibly damaging Het
Taok3 C T 5: 117,273,706 R857C probably damaging Het
Theg G T 10: 79,586,962 D35E probably benign Het
Trio T C 15: 27,832,051 E1245G probably damaging Het
Usp19 C T 9: 108,497,135 H763Y possibly damaging Het
Vmn1r185 A G 7: 26,611,226 S285P probably damaging Het
Vmn1r45 T G 6: 89,933,556 Y144S probably benign Het
Vwa3b G A 1: 37,173,878 E152K probably benign Het
Wdr61 T A 9: 54,719,255 D275V probably damaging Het
Xrcc5 G A 1: 72,394,716 M731I probably benign Het
Zfp619 G A 7: 39,537,363 S939N possibly damaging Het
Zfp874a C A 13: 67,442,299 C422F probably damaging Het
Zfp948 A G 17: 21,588,457 D637G possibly damaging Het
Other mutations in Chsy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Chsy3 APN 18 59176367 missense probably damaging 1.00
IGL01543:Chsy3 APN 18 59410400 nonsense probably null
IGL01627:Chsy3 APN 18 59176295 missense probably damaging 1.00
IGL02232:Chsy3 APN 18 59409311 missense possibly damaging 0.89
IGL02604:Chsy3 APN 18 59409115 missense probably benign 0.00
IGL02888:Chsy3 APN 18 59409995 missense probably benign 0.00
IGL03199:Chsy3 APN 18 59176401 missense probably damaging 1.00
bajo UTSW 18 59176166 frame shift probably null
bajo2 UTSW 18 59176419 missense probably damaging 1.00
P0045:Chsy3 UTSW 18 59409006 nonsense probably null
R0456:Chsy3 UTSW 18 59176478 missense probably damaging 1.00
R0605:Chsy3 UTSW 18 59409053 missense probably damaging 0.97
R1068:Chsy3 UTSW 18 59410289 missense probably damaging 1.00
R1479:Chsy3 UTSW 18 59408913 missense probably benign 0.09
R1654:Chsy3 UTSW 18 59176416 missense probably damaging 1.00
R1868:Chsy3 UTSW 18 59176488 splice site probably null
R1938:Chsy3 UTSW 18 59409512 missense probably damaging 1.00
R2114:Chsy3 UTSW 18 59179489 missense probably damaging 1.00
R2146:Chsy3 UTSW 18 59176472 missense probably benign 0.04
R3693:Chsy3 UTSW 18 59176008 missense possibly damaging 0.88
R3787:Chsy3 UTSW 18 59408998 missense probably damaging 1.00
R3811:Chsy3 UTSW 18 59176170 missense probably benign 0.42
R3878:Chsy3 UTSW 18 59409773 missense probably damaging 1.00
R4385:Chsy3 UTSW 18 59176352 missense probably benign 0.00
R4385:Chsy3 UTSW 18 59179474 missense possibly damaging 0.95
R4512:Chsy3 UTSW 18 59410187 missense probably damaging 1.00
R4734:Chsy3 UTSW 18 59179413 missense probably benign 0.07
R4751:Chsy3 UTSW 18 59175800 missense possibly damaging 0.66
R4982:Chsy3 UTSW 18 59409575 missense probably benign 0.07
R4982:Chsy3 UTSW 18 59409767 missense possibly damaging 0.78
R5032:Chsy3 UTSW 18 59179471 missense probably damaging 1.00
R5088:Chsy3 UTSW 18 59179535 missense probably damaging 1.00
R5220:Chsy3 UTSW 18 59410030 missense probably damaging 0.99
R5257:Chsy3 UTSW 18 59409794 missense possibly damaging 0.50
R5259:Chsy3 UTSW 18 59410246 missense probably damaging 0.96
R5558:Chsy3 UTSW 18 59176397 missense probably damaging 1.00
R5872:Chsy3 UTSW 18 59176196 missense probably damaging 1.00
R5990:Chsy3 UTSW 18 59176166 frame shift probably null
R5992:Chsy3 UTSW 18 59176166 frame shift probably null
R6064:Chsy3 UTSW 18 59176166 frame shift probably null
R6065:Chsy3 UTSW 18 59176166 frame shift probably null
R6182:Chsy3 UTSW 18 59179342 missense probably benign 0.00
R6881:Chsy3 UTSW 18 59179408 missense probably damaging 1.00
R6985:Chsy3 UTSW 18 59176488 splice site probably null
R7078:Chsy3 UTSW 18 59176077 missense possibly damaging 0.51
R7105:Chsy3 UTSW 18 59176419 missense probably damaging 1.00
R7129:Chsy3 UTSW 18 59410298 missense probably damaging 1.00
R7151:Chsy3 UTSW 18 59409285 missense possibly damaging 0.55
R7224:Chsy3 UTSW 18 59408975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGGTACACAGTCATTCTCC -3'
(R):5'- ACAGCGTTGGAGGAAGTCTC -3'

Sequencing Primer
(F):5'- TCTTCTCTTCAAGAGGCCAAAG -3'
(R):5'- GGAAGTCTCCTCTGAAAATCAAGTC -3'
Posted On2019-05-13