Incidental Mutation 'R7057:Muc16'
ID547988
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7057 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18646079 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2973 (S2973P)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: S2973P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,247 V220D probably benign Het
Ankrd1 T C 19: 36,118,233 E113G possibly damaging Het
Aqp12 T C 1: 93,011,996 L249P probably damaging Het
Atg4a-ps A G 3: 103,645,980 F15S possibly damaging Het
Bub1 T A 2: 127,829,527 M46L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2cd4d A G 3: 94,363,493 H22R probably benign Het
Ccdc157 A G 11: 4,144,586 V480A probably benign Het
Cdc42ep3 G A 17: 79,335,523 probably benign Het
Cela1 T A 15: 100,682,893 T161S possibly damaging Het
Chtf18 G T 17: 25,721,126 A697E possibly damaging Het
Cr2 T C 1: 195,151,610 D957G possibly damaging Het
Cyp2c40 A G 19: 39,807,619 V60A probably damaging Het
Dazl CCATGATGGCGGC CC 17: 50,293,406 probably null Het
Dock2 A T 11: 34,227,684 L1824Q probably benign Het
Dock2 T C 11: 34,695,217 Y546C probably benign Het
Fam208a A T 14: 27,461,651 N689I probably damaging Het
Focad G A 4: 88,274,105 C557Y unknown Het
Ftmt T A 18: 52,332,108 N165K probably benign Het
Gen1 A C 12: 11,242,418 S457A probably benign Het
Gja1 T G 10: 56,388,033 S163A probably benign Het
Gm8267 T C 14: 44,722,024 I194M probably damaging Het
Golga3 T A 5: 110,188,663 S389R probably damaging Het
Gpc5 C A 14: 115,133,242 Q87K possibly damaging Het
Hmcn2 G A 2: 31,422,649 A3420T probably damaging Het
Htt A G 5: 34,821,723 S817G probably null Het
Hus1b C T 13: 30,947,550 C42Y possibly damaging Het
Iars2 A G 1: 185,289,367 F913L probably benign Het
Kcna4 A G 2: 107,295,320 E133G probably damaging Het
Klhl36 T C 8: 119,876,797 L597P probably benign Het
Ltv1 T C 10: 13,180,902 E299G possibly damaging Het
Mmp12 A G 9: 7,357,840 Y348C probably damaging Het
Mmp12 G A 9: 7,369,173 V270I probably benign Het
Mmp2 A G 8: 92,831,705 D134G probably damaging Het
Mrpl15 A T 1: 4,776,642 M237K probably benign Het
Ms4a6b G T 19: 11,526,889 V177F possibly damaging Het
Olfr1219 A C 2: 89,074,464 I209S possibly damaging Het
Olfr1445 A T 19: 12,884,642 I254F probably damaging Het
Olfr1477 G T 19: 13,502,879 D179Y probably damaging Het
Olfr390 A C 11: 73,787,148 D70A possibly damaging Het
Olfr912 A T 9: 38,581,754 H159L probably damaging Het
Pikfyve T A 1: 65,247,205 I1201K probably benign Het
Plekhn1 T G 4: 156,233,917 M83L probably damaging Het
Pnlip G T 19: 58,676,263 D212Y probably damaging Het
Pomt2 T C 12: 87,127,378 N417S probably damaging Het
Pxylp1 T A 9: 96,825,050 M360L probably benign Het
Rbak G A 5: 143,173,927 T457I possibly damaging Het
Runx2 A T 17: 44,814,537 W31R probably null Het
Sec16a T A 2: 26,425,265 I1795F probably damaging Het
Sik2 A T 9: 50,998,561 I64N probably damaging Het
Slc26a8 T C 17: 28,638,397 E924G possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc45a4 C A 15: 73,587,638 D174Y probably damaging Het
Slc6a6 A C 6: 91,741,267 E354A probably damaging Het
Slc8a1 A T 17: 81,649,095 S171R probably damaging Het
Srgap1 T C 10: 121,804,953 I669M probably benign Het
Stk39 C A 2: 68,410,127 A87S possibly damaging Het
Tbx18 C A 9: 87,705,264 S600I possibly damaging Het
Tesc A C 5: 118,054,960 K114Q probably damaging Het
Tll1 T C 8: 64,101,881 D256G probably damaging Het
Tmem35b T A 4: 127,127,886 I45K probably benign Het
Tnks T C 8: 34,840,014 D1127G probably damaging Het
Trpm8 A T 1: 88,362,080 D920V probably null Het
U2af1 A T 17: 31,648,857 D79E probably benign Het
Zfp704 T C 3: 9,470,917 D331G probably damaging Het
Znrf3 G T 11: 5,282,442 P261Q probably benign Het
Zscan4b A T 7: 10,901,709 C202* probably null Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGCCTTAGTAGACTTGG -3'
(R):5'- CCTCATTGGTGACTCATGCAG -3'

Sequencing Primer
(F):5'- CTTGGAAAAACTGGACTGTGTC -3'
(R):5'- AAGCAACTTTGGGGGTTTTACCTAC -3'
Posted On2019-05-13