Incidental Mutation 'R7107:Sirpb1c'
ID551219
Institutional Source Beutler Lab
Gene Symbol Sirpb1c
Ensembl Gene ENSMUSG00000074677
Gene Namesignal-regulatory protein beta 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7107 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location15795145-15848528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15838777 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 88 (T88S)
Ref Sequence ENSEMBL: ENSMUSP00000103989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050623] [ENSMUST00000108349] [ENSMUST00000108350] [ENSMUST00000108352] [ENSMUST00000108354]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050623
AA Change: T88S

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061216
Gene: ENSMUSG00000074677
AA Change: T88S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108349
AA Change: T86S

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103986
Gene: ENSMUSG00000074677
AA Change: T86S

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 35 141 3.51e-8 SMART
IGc1 161 234 4.07e-4 SMART
IGc1 264 337 2.21e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108350
AA Change: T88S

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103987
Gene: ENSMUSG00000074677
AA Change: T88S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108352
AA Change: T88S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103989
Gene: ENSMUSG00000074677
AA Change: T88S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108354
AA Change: T88S

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677
AA Change: T88S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148194
SMART Domains Protein: ENSMUSP00000120527
Gene: ENSMUSG00000074677

DomainStartEndE-ValueType
IGc1 32 105 4.07e-4 SMART
IGc1 135 208 2.21e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
Arap2 T A 5: 62,606,208 H1531L probably damaging Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Cep250 A G 2: 155,995,394 T2319A probably benign Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Cpsf4l G A 11: 113,702,489 R90C possibly damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dennd4a G T 9: 64,894,399 L941F possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Mfsd7a T A 5: 108,448,715 probably null Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pfdn1 A T 18: 36,451,466 probably null Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Stab2 T C 10: 86,905,592 D1221G possibly damaging Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zc3h11a T C 1: 133,638,917 T179A probably damaging Het
Zmym2 A G 14: 56,902,712 T3A probably benign Het
Other mutations in Sirpb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Sirpb1c APN 3 15838773 missense probably benign 0.06
R0094:Sirpb1c UTSW 3 15838758 missense possibly damaging 0.73
R0356:Sirpb1c UTSW 3 15833145 missense possibly damaging 0.95
R0442:Sirpb1c UTSW 3 15802546 missense probably benign 0.09
R3731:Sirpb1c UTSW 3 15833123 missense probably damaging 1.00
R4812:Sirpb1c UTSW 3 15833222 missense probably damaging 0.99
R5802:Sirpb1c UTSW 3 15832076 missense probably benign 0.00
R6315:Sirpb1c UTSW 3 15832306 missense possibly damaging 0.71
R7148:Sirpb1c UTSW 3 15833059 nonsense probably null
R7324:Sirpb1c UTSW 3 15848491 unclassified probably benign
R7349:Sirpb1c UTSW 3 15832146 critical splice donor site probably null
R7356:Sirpb1c UTSW 3 15832133 missense probably benign
R7359:Sirpb1c UTSW 3 15833225 missense probably benign 0.02
R7466:Sirpb1c UTSW 3 15832266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGAGCCTTCGGACCTGTAG -3'
(R):5'- AGCTGAAGGTGATCCAACCTG -3'

Sequencing Primer
(F):5'- CCTTCGGACCTGTAGGAGAAATG -3'
(R):5'- CTGAAGGTGATCCAACCTGTTAAATC -3'
Posted On2019-05-15