Incidental Mutation 'R7107:Zmym2'
ID551277
Institutional Source Beutler Lab
Gene Symbol Zmym2
Ensembl Gene ENSMUSG00000021945
Gene Namezinc finger, MYM-type 2
SynonymsRAMP, FIM, MYM, Zfp198, SCLL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R7107 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56886653-56962701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56902712 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3 (T3A)
Ref Sequence ENSEMBL: ENSMUSP00000022511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022511] [ENSMUST00000223669]
Predicted Effect probably benign
Transcript: ENSMUST00000022511
AA Change: T3A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022511
Gene: ENSMUSG00000021945
AA Change: T3A

DomainStartEndE-ValueType
TRASH 330 366 1.55e-5 SMART
TRASH 372 412 7.69e-1 SMART
TRASH 424 459 7.5e1 SMART
TRASH 466 505 6.53e-4 SMART
Pfam:zf-FCS 527 569 1.8e-9 PFAM
TRASH 583 619 4.79e1 SMART
TRASH 638 674 8.49e-3 SMART
TRASH 680 715 7.28e-2 SMART
TRASH 726 761 1.95e-2 SMART
TRASH 767 802 3.89e1 SMART
low complexity region 881 895 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
Pfam:DUF3504 1191 1359 7.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223669
AA Change: T3A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a protein that contains nine MYM-type zinc finger motifs. Expression of this gene may mediate the inhibition of hematopoietic cell development during ontogeny, and the encoded protein may also play a role in transforming growth factor-beta signaling as a Smad binding protein. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
Arap2 T A 5: 62,606,208 H1531L probably damaging Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Cep250 A G 2: 155,995,394 T2319A probably benign Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Cpsf4l G A 11: 113,702,489 R90C possibly damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dennd4a G T 9: 64,894,399 L941F possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Mfsd7a T A 5: 108,448,715 probably null Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pfdn1 A T 18: 36,451,466 probably null Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Sirpb1c T A 3: 15,838,777 T88S possibly damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Stab2 T C 10: 86,905,592 D1221G possibly damaging Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zc3h11a T C 1: 133,638,917 T179A probably damaging Het
Other mutations in Zmym2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Zmym2 APN 14 56947937 splice site probably benign
IGL00587:Zmym2 APN 14 56903360 missense possibly damaging 0.86
IGL00736:Zmym2 APN 14 56903211 missense probably benign 0.01
IGL00753:Zmym2 APN 14 56957060 nonsense probably null
IGL01608:Zmym2 APN 14 56948015 missense possibly damaging 0.57
IGL01744:Zmym2 APN 14 56946572 missense probably benign 0.24
IGL02150:Zmym2 APN 14 56911069 splice site probably benign
IGL02186:Zmym2 APN 14 56943351 missense probably benign 0.09
IGL02654:Zmym2 APN 14 56911315 missense probably damaging 1.00
IGL02960:Zmym2 APN 14 56938413 missense probably benign 0.09
IGL03104:Zmym2 APN 14 56950327 missense possibly damaging 0.88
IGL03162:Zmym2 APN 14 56914043 missense probably benign 0.24
IGL03356:Zmym2 APN 14 56957060 nonsense probably null
IGL03412:Zmym2 APN 14 56959719 nonsense probably null
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0132:Zmym2 UTSW 14 56943258 missense probably benign
R0270:Zmym2 UTSW 14 56949684 splice site probably null
R0834:Zmym2 UTSW 14 56956963 missense probably damaging 1.00
R1071:Zmym2 UTSW 14 56959821 missense possibly damaging 0.93
R1386:Zmym2 UTSW 14 56913091 missense probably damaging 1.00
R1442:Zmym2 UTSW 14 56943327 missense probably damaging 0.99
R1472:Zmym2 UTSW 14 56911183 missense probably benign 0.20
R1595:Zmym2 UTSW 14 56920730 missense probably benign 0.25
R1598:Zmym2 UTSW 14 56902769 missense possibly damaging 0.94
R1598:Zmym2 UTSW 14 56914067 missense probably damaging 1.00
R1916:Zmym2 UTSW 14 56959842 missense probably damaging 1.00
R2261:Zmym2 UTSW 14 56928262 missense probably damaging 1.00
R2393:Zmym2 UTSW 14 56920723 missense probably benign 0.17
R2866:Zmym2 UTSW 14 56928248 missense probably damaging 1.00
R3727:Zmym2 UTSW 14 56919349 splice site probably benign
R3847:Zmym2 UTSW 14 56921499 splice site probably benign
R4043:Zmym2 UTSW 14 56958308 splice site probably benign
R4074:Zmym2 UTSW 14 56903004 missense probably damaging 0.99
R4343:Zmym2 UTSW 14 56921562 missense probably damaging 0.99
R4420:Zmym2 UTSW 14 56956878 missense probably damaging 0.98
R4645:Zmym2 UTSW 14 56928307 missense probably damaging 1.00
R5015:Zmym2 UTSW 14 56921594 missense probably damaging 1.00
R5038:Zmym2 UTSW 14 56956180 missense possibly damaging 0.86
R5223:Zmym2 UTSW 14 56946514 missense probably benign
R5364:Zmym2 UTSW 14 56920645 missense possibly damaging 0.58
R5488:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5489:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5818:Zmym2 UTSW 14 56946529 missense probably benign
R6160:Zmym2 UTSW 14 56950309 missense probably damaging 1.00
R6437:Zmym2 UTSW 14 56903004 missense probably damaging 1.00
R7153:Zmym2 UTSW 14 56950202 missense probably benign 0.16
R7337:Zmym2 UTSW 14 56944100 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATACCTGATGTGGACCCCTTG -3'
(R):5'- ATCAGCAACCAAAGGTGCAG -3'

Sequencing Primer
(F):5'- TTGGAGTTTCAGTTGACACTTAAC -3'
(R):5'- GTACAGGTTCAATAAAAACAACGTC -3'
Posted On2019-05-15