Incidental Mutation 'R0601:Bptf'
ID55433
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Namebromodomain PHD finger transcription factor
Synonyms9430093H17Rik, Falz
MMRRC Submission 038790-MU
Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0601 (G1)
Quality Score220
Status Validated
Chromosome11
Chromosomal Location107033081-107132127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107061692 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 2112 (T2112S)
Ref Sequence ENSEMBL: ENSMUSP00000102373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763] [ENSMUST00000149486]
Predicted Effect probably benign
Transcript: ENSMUST00000057892
AA Change: T2060S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: T2060S

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106762
AA Change: T2112S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: T2112S

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106763
AA Change: T2175S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: T2175S

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149486
AA Change: T276S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122575
Gene: ENSMUSG00000040481
AA Change: T276S

DomainStartEndE-ValueType
coiled coil region 70 98 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Meta Mutation Damage Score 0.1888 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 98% (119/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T G 14: 35,810,189 D143A probably damaging Het
Abca9 C T 11: 110,117,058 probably null Het
Abcc5 A G 16: 20,404,559 probably benign Het
Ablim3 T A 18: 61,849,370 D168V probably benign Het
Acsl3 C T 1: 78,696,179 S352F probably damaging Het
Adgrl4 A T 3: 151,498,429 probably benign Het
Arhgap29 A G 3: 121,991,110 K229E probably damaging Het
Atad3a A T 4: 155,747,407 V470D probably damaging Het
Atp8b1 A G 18: 64,571,653 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bpifa5 A G 2: 154,164,255 N121S possibly damaging Het
Bpifb4 G A 2: 153,947,283 probably benign Het
Btnl4 T C 17: 34,469,311 K498E probably benign Het
Calhm2 A G 19: 47,141,030 probably null Het
Capn3 A T 2: 120,502,596 probably null Het
Caps2 T C 10: 112,195,790 F265L possibly damaging Het
Casp3 G T 8: 46,636,227 C170F probably benign Het
Ccdc39 T C 3: 33,819,839 R615G probably damaging Het
Cd177 A G 7: 24,752,313 I426T probably benign Het
Cfap53 G A 18: 74,300,150 R102H possibly damaging Het
Cfhr3 G A 1: 139,593,885 noncoding transcript Het
Col7a1 T C 9: 108,980,584 probably benign Het
Cplx3 T C 9: 57,606,074 E24G possibly damaging Het
D11Wsu47e T A 11: 113,687,886 S36T probably benign Het
Dhx30 A G 9: 110,086,714 probably null Het
Dnah8 T A 17: 30,708,358 N1329K probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dok3 A T 13: 55,524,263 F201I probably benign Het
Dpf2 A T 19: 5,902,212 H303Q probably damaging Het
Dtnb A G 12: 3,735,039 probably benign Het
Elk3 T C 10: 93,265,481 E136G probably damaging Het
Ephb1 T C 9: 102,195,130 D150G probably damaging Het
Erbb3 A G 10: 128,577,012 S570P probably benign Het
F2 A T 2: 91,633,311 probably null Het
Fanca A T 8: 123,308,513 M231K probably damaging Het
Fbxo34 T C 14: 47,530,257 V358A probably benign Het
Foxp1 C T 6: 98,930,122 E666K probably damaging Het
Fto A G 8: 91,401,802 probably null Het
Gbp2 C T 3: 142,630,758 R290C possibly damaging Het
Grik2 T G 10: 49,422,597 S343R probably damaging Het
Heatr5b A T 17: 78,768,545 M1448K probably benign Het
Hmgn3 A T 9: 83,146,429 probably null Het
Htt T C 5: 34,846,003 V1274A probably benign Het
Kcnh8 A G 17: 52,894,005 D489G probably damaging Het
Kcnip3 A T 2: 127,458,397 probably benign Het
Kdm5a A G 6: 120,402,671 T647A possibly damaging Het
Krt72 T C 15: 101,786,056 R135G probably damaging Het
Larp7 T A 3: 127,544,209 K400N probably damaging Het
Lifr T C 15: 7,169,272 probably null Het
Lima1 G A 15: 99,780,472 P696L probably damaging Het
Lrrc8e T G 8: 4,235,239 probably null Het
Map1a A G 2: 121,298,602 R116G probably damaging Het
Map3k13 A G 16: 21,905,249 E327G possibly damaging Het
Med13 A G 11: 86,345,962 V123A possibly damaging Het
Megf8 A C 7: 25,328,540 H205P probably benign Het
Met G A 6: 17,555,632 probably null Het
Mfsd14b A C 13: 65,087,150 V71G possibly damaging Het
Mpl T A 4: 118,443,536 T599S probably benign Het
Myh15 A T 16: 49,061,581 D62V probably damaging Het
Myo5a A G 9: 75,174,015 T961A probably benign Het
Myrfl A G 10: 116,776,760 Y895H probably damaging Het
Nap1l1 T C 10: 111,490,363 probably benign Het
Ncapd3 T A 9: 27,041,507 Y111N probably benign Het
Nlrc3 A G 16: 3,948,249 probably benign Het
Nsun2 G T 13: 69,633,242 V657L probably benign Het
Olfr1026 A T 2: 85,923,378 I37F probably benign Het
Olfr1247 T A 2: 89,609,220 N294I probably benign Het
Olfr142 T C 2: 90,252,934 D18G probably benign Het
Olfr1511 C A 14: 52,389,826 G316* probably null Het
Olfr195 G A 16: 59,149,754 M301I probably benign Het
Olfr596 T C 7: 103,310,164 S148P probably damaging Het
Olfr646 A T 7: 104,107,142 I288F possibly damaging Het
Olfr780 T A 10: 129,322,016 M131K possibly damaging Het
Osbpl3 A T 6: 50,299,403 V795D probably benign Het
Osbpl5 T C 7: 143,709,549 D155G probably damaging Het
Parm1 G A 5: 91,594,264 V164I probably benign Het
Pgd A T 4: 149,156,810 probably benign Het
Pkp1 G A 1: 135,878,182 R593W probably damaging Het
Polr2l A T 7: 141,473,342 V53E probably damaging Het
Ppp4c G T 7: 126,787,288 T29K probably benign Het
Ppp4r4 T A 12: 103,600,520 probably benign Het
Ptprd A G 4: 76,100,474 S688P probably benign Het
Rab3b A T 4: 108,890,389 I28F probably damaging Het
Rnase4 T C 14: 51,105,095 L92P probably benign Het
Rnpc3 T C 3: 113,620,106 E229G probably benign Het
Rtraf A T 14: 19,816,206 D147E possibly damaging Het
Rttn G A 18: 89,042,966 G1086D probably benign Het
Ryr2 A G 13: 11,705,633 probably null Het
Sft2d2 T C 1: 165,183,861 I126V probably benign Het
Skap1 G T 11: 96,723,410 probably benign Het
Slc14a2 A T 18: 78,157,179 L753* probably null Het
Slc25a5 G A X: 36,795,755 A9T probably benign Het
Slc30a5 T C 13: 100,814,770 probably benign Het
Slc5a4b A C 10: 76,064,036 I456S possibly damaging Het
Slc9a4 A T 1: 40,603,070 S400C probably damaging Het
Slx1b T A 7: 126,692,640 H84L probably damaging Het
Sptbn1 T C 11: 30,150,008 Y190C probably damaging Het
Stk32b T C 5: 37,531,566 Q138R probably damaging Het
Syt6 C A 3: 103,620,890 D308E probably damaging Het
Sytl2 G A 7: 90,395,166 D572N probably damaging Het
Taok2 A T 7: 126,879,433 L109Q probably damaging Het
Tbl1xr1 T C 3: 22,179,319 probably benign Het
Tlk1 A G 2: 70,714,158 I711T probably benign Het
Trf A G 9: 103,222,933 probably null Het
Trpc2 A G 7: 102,084,365 T548A possibly damaging Het
Ttbk2 A T 2: 120,825,296 I29N possibly damaging Het
Tti1 A T 2: 157,993,372 C989S probably damaging Het
Txndc8 A G 4: 58,000,256 Y108H probably benign Het
Ugt2b1 A T 5: 86,917,680 V500D possibly damaging Het
Vmn1r34 A G 6: 66,637,664 I30T possibly damaging Het
Vmn2r115 A G 17: 23,360,100 K849R probably null Het
Vmn2r76 T A 7: 86,226,115 probably null Het
Vps13c T A 9: 67,927,472 S1694R probably benign Het
Wdfy3 G T 5: 101,836,172 P3509T probably benign Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wdr60 T C 12: 116,255,935 D129G possibly damaging Het
Wnt8b T A 19: 44,493,667 W40R probably benign Het
Xrra1 A G 7: 99,910,968 I384V possibly damaging Het
Zfp11 A T 5: 129,657,907 H163Q probably damaging Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 107055279 missense possibly damaging 0.88
IGL00664:Bptf APN 11 107077665 missense possibly damaging 0.78
IGL00705:Bptf APN 11 107095708 splice site probably benign
IGL00796:Bptf APN 11 107054550 missense probably damaging 1.00
IGL00834:Bptf APN 11 107073928 missense possibly damaging 0.59
IGL01155:Bptf APN 11 107080727 missense probably damaging 1.00
IGL01314:Bptf APN 11 107054853 missense probably damaging 1.00
IGL01371:Bptf APN 11 107055907 missense probably benign 0.00
IGL01567:Bptf APN 11 107058774 missense probably damaging 1.00
IGL01794:Bptf APN 11 107053221 critical splice donor site probably null
IGL02108:Bptf APN 11 107074988 missense probably benign 0.45
IGL02367:Bptf APN 11 107073352 missense probably benign
IGL02437:Bptf APN 11 107074695 missense probably benign 0.00
IGL02589:Bptf APN 11 107111531 missense possibly damaging 0.92
IGL02897:Bptf APN 11 107047121 missense probably damaging 1.00
IGL02935:Bptf APN 11 107080799 missense probably damaging 1.00
IGL02954:Bptf APN 11 107054749 missense possibly damaging 0.89
IGL02982:Bptf APN 11 107076674 missense probably damaging 1.00
IGL03109:Bptf APN 11 107061701 missense possibly damaging 0.53
IGL03265:Bptf APN 11 107054628 missense probably benign 0.00
IGL03403:Bptf APN 11 107099733 missense possibly damaging 0.51
IGL03097:Bptf UTSW 11 107077680 missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 107054788 missense probably damaging 0.98
R0066:Bptf UTSW 11 107062136 missense possibly damaging 0.90
R0157:Bptf UTSW 11 107074658 missense possibly damaging 0.89
R0320:Bptf UTSW 11 107072819 missense probably damaging 1.00
R0328:Bptf UTSW 11 107047127 missense probably damaging 1.00
R0402:Bptf UTSW 11 107074114 missense probably damaging 1.00
R0482:Bptf UTSW 11 107081262 missense probably benign 0.13
R0574:Bptf UTSW 11 107076527 missense probably damaging 1.00
R0598:Bptf UTSW 11 107072965 missense probably damaging 0.99
R0599:Bptf UTSW 11 107068382 missense probably damaging 1.00
R0744:Bptf UTSW 11 107110812 critical splice donor site probably null
R0836:Bptf UTSW 11 107110812 critical splice donor site probably null
R0885:Bptf UTSW 11 107043791 missense probably damaging 1.00
R1070:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1252:Bptf UTSW 11 107073251 missense probably benign 0.00
R1370:Bptf UTSW 11 107047094 missense probably damaging 0.99
R1428:Bptf UTSW 11 107073047 missense probably damaging 0.99
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1467:Bptf UTSW 11 107055055 missense possibly damaging 0.92
R1742:Bptf UTSW 11 107110951 missense probably damaging 1.00
R1816:Bptf UTSW 11 107060579 missense probably damaging 1.00
R1858:Bptf UTSW 11 107073301 missense probably benign 0.00
R1989:Bptf UTSW 11 107074826 missense probably damaging 1.00
R2253:Bptf UTSW 11 107111322 missense probably damaging 1.00
R2392:Bptf UTSW 11 107072747 missense probably damaging 1.00
R2431:Bptf UTSW 11 107047240 missense possibly damaging 0.48
R3022:Bptf UTSW 11 107111637 critical splice acceptor site probably null
R3161:Bptf UTSW 11 107074476 missense probably damaging 1.00
R3686:Bptf UTSW 11 107074198 missense probably benign 0.25
R3687:Bptf UTSW 11 107074198 missense probably benign 0.25
R3688:Bptf UTSW 11 107074198 missense probably benign 0.25
R3787:Bptf UTSW 11 107073827 missense probably damaging 1.00
R3834:Bptf UTSW 11 107073857 missense probably benign 0.05
R3885:Bptf UTSW 11 107074513 missense probably damaging 0.97
R4090:Bptf UTSW 11 107081523 missense probably damaging 0.99
R4398:Bptf UTSW 11 107110844 missense probably damaging 1.00
R4437:Bptf UTSW 11 107074474 missense possibly damaging 0.59
R4514:Bptf UTSW 11 107077692 missense probably damaging 1.00
R4565:Bptf UTSW 11 107073010 missense probably damaging 1.00
R4715:Bptf UTSW 11 107047181 missense probably damaging 1.00
R4748:Bptf UTSW 11 107095880 missense probably damaging 0.96
R4764:Bptf UTSW 11 107043694 missense probably damaging 1.00
R4885:Bptf UTSW 11 107074648 missense probably benign 0.39
R4901:Bptf UTSW 11 107110860 nonsense probably null
R4995:Bptf UTSW 11 107054565 missense probably damaging 0.98
R5057:Bptf UTSW 11 107082528 missense probably damaging 0.98
R5120:Bptf UTSW 11 107073385 missense probably damaging 0.99
R5320:Bptf UTSW 11 107081367 nonsense probably null
R5329:Bptf UTSW 11 107073295 missense probably benign 0.06
R5418:Bptf UTSW 11 107111294 missense probably damaging 1.00
R5461:Bptf UTSW 11 107061764 missense probably damaging 1.00
R5664:Bptf UTSW 11 107073699 missense probably benign 0.01
R5718:Bptf UTSW 11 107111434 missense probably damaging 1.00
R5774:Bptf UTSW 11 107111137 missense probably damaging 1.00
R5851:Bptf UTSW 11 107110862 missense probably damaging 1.00
R5930:Bptf UTSW 11 107073196 missense probably damaging 1.00
R5949:Bptf UTSW 11 107111089 missense probably damaging 0.99
R5975:Bptf UTSW 11 107035864 utr 3 prime probably benign
R6027:Bptf UTSW 11 107074945 missense probably damaging 1.00
R6128:Bptf UTSW 11 107074690 missense possibly damaging 0.87
R6337:Bptf UTSW 11 107058779 missense possibly damaging 0.89
R6407:Bptf UTSW 11 107111126 missense probably damaging 1.00
R6470:Bptf UTSW 11 107072767 missense probably damaging 1.00
R6487:Bptf UTSW 11 107077726 missense probably damaging 0.99
R6501:Bptf UTSW 11 107077683 missense probably null 1.00
R6755:Bptf UTSW 11 107047256 missense probably benign 0.27
R6861:Bptf UTSW 11 107062565 missense probably damaging 1.00
R6866:Bptf UTSW 11 107073580 missense probably damaging 1.00
R6879:Bptf UTSW 11 107042690 missense probably benign 0.32
R6927:Bptf UTSW 11 107054595 missense probably damaging 1.00
R6944:Bptf UTSW 11 107080823 missense probably damaging 1.00
R7082:Bptf UTSW 11 107086747 missense probably benign 0.00
R7136:Bptf UTSW 11 107099715 missense probably damaging 1.00
R7162:Bptf UTSW 11 107043631 critical splice donor site probably null
R7171:Bptf UTSW 11 107131407 missense unknown
R7193:Bptf UTSW 11 107054809 nonsense probably null
R7210:Bptf UTSW 11 107054464 nonsense probably null
R7221:Bptf UTSW 11 107054832 missense probably damaging 1.00
R7316:Bptf UTSW 11 107073109 missense probably damaging 1.00
R7316:Bptf UTSW 11 107110914 nonsense probably null
R7422:Bptf UTSW 11 107060558 missense probably damaging 1.00
R7454:Bptf UTSW 11 107044640 missense probably benign 0.03
Z1088:Bptf UTSW 11 107074582 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGTTACCAAGTGCAGCACATTCC -3'
(R):5'- TAAGGCATGGTCCAGGTACAGCAG -3'

Sequencing Primer
(F):5'- acccctttaatcccagcac -3'
(R):5'- CCAGGTACAGCAGAAGGTCC -3'
Posted On2013-07-11