Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4585001:Ucp1'

556606

Institutional Source

Beutler Lab

Gene Symbol

Ucp1

Ensembl Gene

ENSMUSG00000031710

Gene Name

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms

Slc25a7

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4585001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84016981-84025081 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84020577 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 129 (F129S)

Ref Sequence

ENSEMBL: ENSMUSP00000034146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034146]

AlphaFold

P12242

Predicted Effect

probably damaging
Transcript: ENSMUST00000034146
AA Change: F129S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: F129S

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,199,117 (GRCm39)	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,531,342 (GRCm39)	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,872,988 (GRCm39)	T202S	probably benign	Het
Cdc42bpb	T	C	12: 111,271,412 (GRCm39)	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,390,285 (GRCm39)	N156K	probably damaging	Het
Cox18	G	A	5: 90,365,434 (GRCm39)	T255I	possibly damaging	Het
Cse1l	A	G	2: 166,783,394 (GRCm39)	T783A	probably damaging	Het
Dnajc16	T	C	4: 141,491,996 (GRCm39)	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,056,630 (GRCm39)	T339A	probably benign	Het
Eif5a	T	C	11: 69,808,896 (GRCm39)		probably benign	Het
Epha3	A	G	16: 63,386,940 (GRCm39)		probably null	Het
Esco1	A	T	18: 10,594,355 (GRCm39)	C310*	probably null	Het
Fam222a	A	G	5: 114,749,101 (GRCm39)	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,496,573 (GRCm39)	L339P	probably damaging	Het
Gfral	A	T	9: 76,104,576 (GRCm39)	N145K	probably damaging	Het
Gga1	T	A	15: 78,777,990 (GRCm39)	N618K	probably benign	Het
Gpatch3	T	A	4: 133,310,397 (GRCm39)	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,666,747 (GRCm39)	R346*	probably null	Het
Gsg1	T	C	6: 135,214,558 (GRCm39)	E317G	probably benign	Het
Gsk3b	A	G	16: 38,004,816 (GRCm39)	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,184,789 (GRCm39)	D94E	possibly damaging	Het
Kash5	C	T	7: 44,849,695 (GRCm39)	G76D	probably benign	Het
Klhdc9	T	A	1: 171,187,386 (GRCm39)	H204L	possibly damaging	Het
Klhl24	A	G	16: 19,925,638 (GRCm39)	I55M	probably benign	Het
Kmt2c	T	C	5: 25,520,104 (GRCm39)	D2002G	probably benign	Het
Lama4	A	G	10: 38,950,742 (GRCm39)	N1015S	probably damaging	Het
Lpp	T	C	16: 24,580,697 (GRCm39)	C263R	probably benign	Het
Lrp1b	T	C	2: 41,159,216 (GRCm39)	I1689V		Het
Mipep	C	A	14: 61,022,284 (GRCm39)	Q50K	probably benign	Het
Mx1	T	C	16: 97,257,454 (GRCm39)	D101G	probably benign	Het
Nabp2	C	G	10: 128,244,676 (GRCm39)	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,671,104 (GRCm39)	I115V	possibly damaging	Het
Nup93	A	T	8: 94,970,355 (GRCm39)	T85S	probably benign	Het
Oit3	T	A	10: 59,266,835 (GRCm39)	I224F	possibly damaging	Het
Parp14	T	C	16: 35,678,975 (GRCm39)	K331R	probably benign	Het
Pls1	T	A	9: 95,643,443 (GRCm39)	T519S	probably benign	Het
Rcn3	A	G	7: 44,736,118 (GRCm39)	F197L	probably benign	Het
Rnf213	C	T	11: 119,349,218 (GRCm39)	T3773I		Het
Rprd1b	A	T	2: 157,889,877 (GRCm39)	I153L	probably benign	Het
Scel	A	G	14: 103,829,804 (GRCm39)	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,794,276 (GRCm39)	S548L	possibly damaging	Het
Sim1	T	A	10: 50,860,284 (GRCm39)	Y715*	probably null	Het
Slc18a2	A	T	19: 59,282,293 (GRCm39)	Q500L	possibly damaging	Het
Slc5a8	T	G	10: 88,722,365 (GRCm39)	M66R	probably damaging	Het
Slco1a6	T	C	6: 142,055,246 (GRCm39)	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623 (GRCm39)	T396A	probably benign	Het
Tas2r104	T	C	6: 131,662,521 (GRCm39)	T63A	possibly damaging	Het
Tasor2	G	A	13: 3,624,979 (GRCm39)	A1657V	possibly damaging	Het
Top2a	C	T	11: 98,892,199 (GRCm39)	A1088T	probably benign	Het
Unc13b	T	A	4: 43,091,298 (GRCm39)	D41E	probably benign	Het
Usp10	T	G	8: 120,681,631 (GRCm39)	V696G	probably benign	Het
Xylt2	C	T	11: 94,557,066 (GRCm39)	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,373,820 (GRCm39)	N41K	probably damaging	Het
Zfp109	T	A	7: 23,928,779 (GRCm39)	D218V	probably benign	Het
Zfp420	G	A	7: 29,575,430 (GRCm39)	R550Q	probably benign	Het

Other mutations in Ucp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0050:Ucp1	UTSW	8	84,020,857 (GRCm39)	missense	probably damaging	1.00
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0505:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0590:Ucp1	UTSW	8	84,018,232 (GRCm39)	splice site	probably benign
R0681:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0731:Ucp1	UTSW	8	84,024,476 (GRCm39)	splice site	probably benign
R1606:Ucp1	UTSW	8	84,021,933 (GRCm39)	missense	probably damaging	1.00
R1722:Ucp1	UTSW	8	84,017,317 (GRCm39)	missense	probably benign	0.25
R1809:Ucp1	UTSW	8	84,024,496 (GRCm39)	missense	probably damaging	0.99
R1823:Ucp1	UTSW	8	84,020,661 (GRCm39)	missense	probably damaging	1.00
R3809:Ucp1	UTSW	8	84,017,270 (GRCm39)	missense	probably damaging	0.99
R4085:Ucp1	UTSW	8	84,020,580 (GRCm39)	missense	probably benign	0.43
R4673:Ucp1	UTSW	8	84,021,876 (GRCm39)	missense	probably damaging	1.00
R4998:Ucp1	UTSW	8	84,024,484 (GRCm39)	critical splice acceptor site	probably null
R5163:Ucp1	UTSW	8	84,020,832 (GRCm39)	missense	possibly damaging	0.95
R5421:Ucp1	UTSW	8	84,017,320 (GRCm39)	missense	probably benign	0.12
R5790:Ucp1	UTSW	8	84,024,520 (GRCm39)	missense	possibly damaging	0.54
R5994:Ucp1	UTSW	8	84,020,567 (GRCm39)	missense	possibly damaging	0.92
R6574:Ucp1	UTSW	8	84,020,718 (GRCm39)	critical splice donor site	probably null
R6732:Ucp1	UTSW	8	84,018,106 (GRCm39)	missense	probably benign	0.08
R7282:Ucp1	UTSW	8	84,020,531 (GRCm39)	missense	probably benign	0.03
R7343:Ucp1	UTSW	8	84,021,881 (GRCm39)	missense	probably damaging	0.99
R7878:Ucp1	UTSW	8	84,024,521 (GRCm39)	missense	probably benign	0.19
R8008:Ucp1	UTSW	8	84,020,640 (GRCm39)	missense	probably benign	0.32
R8365:Ucp1	UTSW	8	84,020,628 (GRCm39)	missense	probably damaging	0.97
R8899:Ucp1	UTSW	8	84,017,216 (GRCm39)	missense	probably benign	0.35
R9186:Ucp1	UTSW	8	84,017,272 (GRCm39)	nonsense	probably null
R9499:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9551:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9552:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTTCCTGAAGTAGCGTGG -3'
(R):5'- ACTGTGGCTGTTCACTTGGC -3'

Sequencing Primer
(F):5'- AGAGTTTGTCCTCTGTGCAC -3'
(R):5'- GGCAGTTAGCTACCTTTCCAAAGTG -3'

Posted On

2019-06-07