Incidental Mutation 'R7177:Olfr1307'
ID558661
Institutional Source Beutler Lab
Gene Symbol Olfr1307
Ensembl Gene ENSMUSG00000094747
Gene Nameolfactory receptor 1307
SynonymsMOR245-19P, GA_x6K02T2Q125-72988111-72987173
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111930116-111949440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111945156 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 100 (Q100L)
Ref Sequence ENSEMBL: ENSMUSP00000097199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000099606]
Predicted Effect probably damaging
Transcript: ENSMUST00000099604
AA Change: Q100L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: Q100L

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099606
AA Change: Q100L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097201
Gene: ENSMUSG00000094747
AA Change: Q100L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-42 PFAM
Pfam:7tm_1 41 287 6.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Olfr1307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Olfr1307 APN 2 111944518 makesense probably null
IGL01947:Olfr1307 APN 2 111944994 missense probably benign 0.26
IGL02373:Olfr1307 APN 2 111944833 missense probably benign 0.01
IGL02682:Olfr1307 APN 2 111944940 missense probably damaging 1.00
R0714:Olfr1307 UTSW 2 111944553 missense probably benign 0.01
R1670:Olfr1307 UTSW 2 111944919 missense probably damaging 1.00
R1730:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R1733:Olfr1307 UTSW 2 111945280 missense probably benign 0.13
R1773:Olfr1307 UTSW 2 111944859 missense possibly damaging 0.55
R1783:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R2180:Olfr1307 UTSW 2 111945003 missense probably benign 0.39
R2197:Olfr1307 UTSW 2 111945313 missense possibly damaging 0.64
R2207:Olfr1307 UTSW 2 111944925 missense probably damaging 1.00
R2377:Olfr1307 UTSW 2 111944643 missense probably damaging 1.00
R4425:Olfr1307 UTSW 2 111945189 missense probably benign 0.00
R4595:Olfr1307 UTSW 2 111944652 missense possibly damaging 0.86
R4859:Olfr1307 UTSW 2 111944811 missense probably damaging 0.98
R4910:Olfr1307 UTSW 2 111945078 missense possibly damaging 0.69
R5167:Olfr1307 UTSW 2 111945102 missense probably damaging 1.00
R5537:Olfr1307 UTSW 2 111945048 missense probably damaging 1.00
R6328:Olfr1307 UTSW 2 111945394 missense probably null 0.41
R6877:Olfr1307 UTSW 2 111944839 missense probably benign 0.16
R7011:Olfr1307 UTSW 2 111944686 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTCACAGTAGAAGCTGTCC -3'
(R):5'- TCGTGTTCACTGTGGCATC -3'

Sequencing Primer
(F):5'- CAGTAGAAGCTGTCCAACACATTTG -3'
(R):5'- GTGTTCACTGTGGCATCTGACC -3'
Posted On2019-06-26