Incidental Mutation 'R7212:Hipk1'
ID561127
Institutional Source Beutler Lab
Gene Symbol Hipk1
Ensembl Gene ENSMUSG00000008730
Gene Namehomeodomain interacting protein kinase 1
Synonyms1110062K04Rik, Myak
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7212 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103739815-103791563 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 103777610 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 230 (Q230*)
Ref Sequence ENSEMBL: ENSMUSP00000029438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029438] [ENSMUST00000106845] [ENSMUST00000118317] [ENSMUST00000137078]
Predicted Effect probably null
Transcript: ENSMUST00000029438
AA Change: Q230*
SMART Domains Protein: ENSMUSP00000029438
Gene: ENSMUSG00000008730
AA Change: Q230*

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106845
AA Change: Q230*
SMART Domains Protein: ENSMUSP00000102458
Gene: ENSMUSG00000008730
AA Change: Q230*

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1050 1066 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118317
AA Change: Q230*
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730
AA Change: Q230*

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137078
AA Change: Q230*
SMART Domains Protein: ENSMUSP00000120396
Gene: ENSMUSG00000008730
AA Change: Q230*

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 672 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, do not develop spontaneous tumors, and are resistant to DMBA-induced skin tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Atp6v0a1 T C 11: 101,043,957 F617L probably benign Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clca1 A C 3: 145,005,966 I756S probably damaging Het
Clcn1 T C 6: 42,291,389 V165A possibly damaging Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1354 A T 10: 78,917,505 I222L possibly damaging Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tmod1 A T 4: 46,093,951 K221* probably null Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Hipk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Hipk1 APN 3 103778160 missense possibly damaging 0.49
IGL01024:Hipk1 APN 3 103760636 missense probably benign 0.31
IGL01069:Hipk1 APN 3 103777699 missense possibly damaging 0.95
IGL01798:Hipk1 APN 3 103761559 missense probably damaging 0.99
IGL01937:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL01945:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL02184:Hipk1 APN 3 103758750 missense possibly damaging 0.96
IGL02430:Hipk1 APN 3 103760655 missense probably damaging 1.00
IGL02603:Hipk1 APN 3 103750272 missense probably damaging 0.97
IGL02632:Hipk1 APN 3 103760545 missense probably benign 0.14
IGL02686:Hipk1 APN 3 103778017 missense possibly damaging 0.82
IGL03293:Hipk1 APN 3 103777259 missense possibly damaging 0.83
effluvient UTSW 3 103754325 splice site probably null
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0512:Hipk1 UTSW 3 103760574 missense possibly damaging 0.95
R0741:Hipk1 UTSW 3 103746812 missense probably benign 0.17
R0785:Hipk1 UTSW 3 103754325 splice site probably null
R0786:Hipk1 UTSW 3 103744304 missense probably benign
R0833:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R0836:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R1165:Hipk1 UTSW 3 103761524 missense possibly damaging 0.62
R1322:Hipk1 UTSW 3 103743981 missense probably damaging 1.00
R1384:Hipk1 UTSW 3 103758774 splice site probably benign
R1521:Hipk1 UTSW 3 103777782 missense probably benign 0.16
R1543:Hipk1 UTSW 3 103778164 missense probably benign 0.00
R2085:Hipk1 UTSW 3 103750354 missense probably benign 0.00
R2158:Hipk1 UTSW 3 103760538 missense probably damaging 1.00
R2291:Hipk1 UTSW 3 103761610 missense probably damaging 1.00
R3522:Hipk1 UTSW 3 103744114 missense probably damaging 0.96
R4516:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4518:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4884:Hipk1 UTSW 3 103744022 missense possibly damaging 0.47
R5023:Hipk1 UTSW 3 103777507 missense probably damaging 1.00
R6045:Hipk1 UTSW 3 103746902 missense probably benign 0.45
R6641:Hipk1 UTSW 3 103753405 missense probably damaging 0.99
R6904:Hipk1 UTSW 3 103777512 missense possibly damaging 0.90
R6925:Hipk1 UTSW 3 103778245 missense unknown
R7169:Hipk1 UTSW 3 103744217 missense probably benign
R7313:Hipk1 UTSW 3 103778258 missense unknown
Z1088:Hipk1 UTSW 3 103764544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACCTGCTGCAAGATTGGTC -3'
(R):5'- TAGCAGTTCCAGCGGAGAAG -3'

Sequencing Primer
(F):5'- CACCTGCTGCAAGATTGGTCTTATG -3'
(R):5'- TTCCAGCGGAGAAGGGGATTAC -3'
Posted On2019-06-26