Incidental Mutation 'R7236:B3galnt1'
ID562806
Institutional Source Beutler Lab
Gene Symbol B3galnt1
Ensembl Gene ENSMUSG00000043300
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
SynonymsBrainiac 1, B3galt3, Globoside blood group, Mbrn 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7236 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69574158-69598960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69575617 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 104 (K104E)
Ref Sequence ENSEMBL: ENSMUSP00000058363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061826]
Predicted Effect probably benign
Transcript: ENSMUST00000061826
AA Change: K104E

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058363
Gene: ENSMUSG00000043300
AA Change: K104E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 92 285 4.5e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. [provided by RefSeq, Mar 2017]
PHENOTYPE: A homozygous null mutation of this gene results in embryonic lethality. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 C T 19: 4,871,616 V179I probably benign Het
Adra1b A G 11: 43,776,324 I362T possibly damaging Het
Bnc2 T C 4: 84,555,864 Y15C probably benign Het
C2cd2l C A 9: 44,317,663 A124S possibly damaging Het
Camsap3 T A 8: 3,604,116 F595L probably damaging Het
Cct2 A T 10: 117,061,559 D93E probably benign Het
Cemip A T 7: 83,948,804 probably null Het
Ciapin1 T C 8: 94,823,710 T34A Het
Dopey1 G A 9: 86,515,378 V912I probably damaging Het
Eif3c T C 7: 126,552,323 T610A possibly damaging Het
Ephb3 A G 16: 21,214,481 R106G probably damaging Het
Ephx3 T A 17: 32,185,354 probably null Het
Etv2 A T 7: 30,635,030 S93T probably benign Het
Fbxo34 T A 14: 47,530,384 D451E probably benign Het
Fmo9 A G 1: 166,676,571 F141L probably damaging Het
Fryl T C 5: 73,108,478 K500R possibly damaging Het
Gfra3 T C 18: 34,695,831 D170G probably damaging Het
Gm11639 A T 11: 104,899,267 Q2832L probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm17783 A T 16: 45,527,667 I169N possibly damaging Het
Gm4869 G T 5: 140,471,645 A390S probably benign Het
Gnptg T C 17: 25,239,923 N34S possibly damaging Het
Golga5 T A 12: 102,474,775 probably null Het
Herc2 G T 7: 56,085,080 L139F probably benign Het
Ikzf2 T A 1: 69,539,081 N423I probably benign Het
Il31ra A T 13: 112,523,905 *717R probably null Het
Itga2 G T 13: 114,877,691 Q234K probably benign Het
Kcnt1 A T 2: 25,909,939 probably null Het
Man2a2 T C 7: 80,368,905 S69G probably damaging Het
Mccc1 A G 3: 35,983,795 V294A probably benign Het
Mphosph8 T A 14: 56,674,297 I259K possibly damaging Het
Mrpl15 A T 1: 4,776,488 N288K probably benign Het
Msantd2 T C 9: 37,489,669 W116R probably damaging Het
Mtmr10 T C 7: 64,314,184 probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Nhsl1 A G 10: 18,525,764 K879E probably damaging Het
Olfr1062 A T 2: 86,423,189 C162* probably null Het
Pak6 A G 2: 118,693,428 T355A probably benign Het
Patj C T 4: 98,411,057 R139C probably damaging Het
Pcdhb3 C T 18: 37,301,452 A157V probably damaging Het
Phkg1 C A 5: 129,866,961 D150Y probably damaging Het
Ppp2r5c C T 12: 110,465,889 S45L probably benign Het
Prl4a1 A C 13: 28,018,573 T44P probably benign Het
Ptpro G A 6: 137,368,337 V114M probably damaging Het
Pwp1 A G 10: 85,879,283 N211S probably benign Het
Ralgapb A G 2: 158,440,827 D504G probably benign Het
Rock2 A T 12: 16,929,002 I98F probably damaging Het
Senp6 G T 9: 80,132,965 V785L probably damaging Het
Simc1 A G 13: 54,524,796 D319G probably benign Het
Tas2r105 A T 6: 131,686,760 I235N probably damaging Het
Tas2r110 A T 6: 132,868,704 M233L possibly damaging Het
Tmem260 C T 14: 48,509,190 probably null Het
Trank1 G T 9: 111,373,074 V1590L possibly damaging Het
Tsc2 A T 17: 24,623,594 M286K possibly damaging Het
Ttn T C 2: 76,867,452 T202A Het
Ttyh1 A G 7: 4,133,664 N424D probably benign Het
Usp24 T A 4: 106,406,305 probably null Het
Utp20 G T 10: 88,749,342 P2620Q probably benign Het
Vmn1r45 A G 6: 89,933,151 M279T probably benign Het
Vmn2r115 T A 17: 23,359,602 I683K probably benign Het
Vmn2r34 T C 7: 7,681,751 K481E probably damaging Het
Vmn2r54 T A 7: 12,631,990 H339L possibly damaging Het
Vmn2r94 T A 17: 18,257,549 N200I possibly damaging Het
Wdfy3 A G 5: 101,836,208 Y3493H probably damaging Het
Wdr5b A G 16: 36,041,838 D109G possibly damaging Het
Zfp286 A T 11: 62,783,670 probably null Het
Other mutations in B3galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0101:B3galnt1 UTSW 3 69575806 missense probably benign 0.01
R0230:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R1580:B3galnt1 UTSW 3 69575707 missense possibly damaging 0.95
R1628:B3galnt1 UTSW 3 69575628 missense probably damaging 1.00
R1942:B3galnt1 UTSW 3 69575925 start codon destroyed probably null 0.90
R5137:B3galnt1 UTSW 3 69574949 missense probably benign 0.01
R6418:B3galnt1 UTSW 3 69574993 missense probably damaging 1.00
R6468:B3galnt1 UTSW 3 69575533 missense probably damaging 1.00
R6473:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R7363:B3galnt1 UTSW 3 69575824 missense probably damaging 1.00
R7501:B3galnt1 UTSW 3 69575299 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGGGGCAAAACTCCATTACC -3'
(R):5'- CCCCACTACAATGTGATCGAG -3'

Sequencing Primer
(F):5'- TTACCCACCTGAAAGCCATAATGG -3'
(R):5'- TACAATGTGATCGAGCGCGTC -3'
Posted On2019-06-26