Incidental Mutation 'R5137:B3galnt1'
ID396192
Institutional Source Beutler Lab
Gene Symbol B3galnt1
Ensembl Gene ENSMUSG00000043300
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
SynonymsBrainiac 1, B3galt3, Globoside blood group, Mbrn 1
MMRRC Submission 042723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5137 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location69574158-69598960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69574949 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 326 (N326K)
Ref Sequence ENSEMBL: ENSMUSP00000058363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061826]
Predicted Effect probably benign
Transcript: ENSMUST00000061826
AA Change: N326K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058363
Gene: ENSMUSG00000043300
AA Change: N326K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 92 285 4.5e-68 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. [provided by RefSeq, Mar 2017]
PHENOTYPE: A homozygous null mutation of this gene results in embryonic lethality. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,069,771 V75A probably benign Het
Ace G C 11: 105,974,826 W628C probably damaging Het
Adh4 T C 3: 138,422,235 S141P probably benign Het
Apob T C 12: 8,011,384 Y3256H possibly damaging Het
Catsperb T C 12: 101,549,811 F569L probably damaging Het
Cecr2 A G 6: 120,755,517 I225V probably benign Het
Cox5b A G 1: 36,692,429 probably null Het
Crybg1 T C 10: 43,958,336 D1953G probably damaging Het
Dnaaf5 C T 5: 139,181,460 T707M probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ebf1 G A 11: 44,991,468 R409Q probably damaging Het
Eef2k G A 7: 120,885,422 A256T probably damaging Het
Eef2k C A 7: 120,885,423 A256D probably damaging Het
Evl C G 12: 108,681,522 T294S probably benign Het
Eya2 T C 2: 165,731,628 Y288H probably damaging Het
Ezh2 A T 6: 47,532,080 probably null Het
Fam171a1 T C 2: 3,225,389 Y395H probably benign Het
Gas2l3 C A 10: 89,413,975 R427L probably damaging Het
Gli2 T A 1: 118,855,503 I91F probably damaging Het
Gm4884 T C 7: 41,042,894 S96P probably damaging Het
Gprc5d T A 6: 135,116,033 D292V probably benign Het
Herc1 A G 9: 66,448,223 K2252R probably benign Het
Il1rl1 A T 1: 40,450,125 M346L probably benign Het
Kcna5 A T 6: 126,533,983 V394D probably damaging Het
Kcng4 A T 8: 119,625,878 M431K possibly damaging Het
Kif1bp A T 10: 62,578,241 V46E probably damaging Het
Large1 A G 8: 73,048,309 F258L possibly damaging Het
Mapkbp1 T A 2: 120,022,181 C1001S probably damaging Het
Micu1 A G 10: 59,827,232 Q328R probably benign Het
Mmp11 G A 10: 75,925,456 P437S probably damaging Het
Msh6 T A 17: 87,980,288 F119I possibly damaging Het
Myo6 A G 9: 80,242,249 E159G probably damaging Het
Negr1 T A 3: 157,016,196 Y136N probably damaging Het
Nol9 T A 4: 152,045,971 C321S probably damaging Het
Nos1 T C 5: 117,905,313 F551S probably benign Het
Nup153 C A 13: 46,684,153 G1198C probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1225 C A 2: 89,170,400 V271F probably benign Het
Olfr395 T C 11: 73,906,626 I289V probably damaging Het
Olfr606 A G 7: 103,451,712 Y125C probably damaging Het
Olfr606 C A 7: 103,451,713 Y125* probably null Het
Omd T C 13: 49,590,076 S201P probably benign Het
Oxct1 G T 15: 4,035,350 A57S probably benign Het
Pcdhga7 T G 18: 37,717,380 S813R probably damaging Het
Pcmtd2 A T 2: 181,854,994 I255F possibly damaging Het
Pdk1 T G 2: 71,883,569 M186R possibly damaging Het
Pelp1 T C 11: 70,395,099 T648A probably damaging Het
Phldb2 A T 16: 45,808,258 S570R possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Ptprj T C 2: 90,469,648 T270A possibly damaging Het
Reln C T 5: 21,955,181 G2130D probably damaging Het
Rims1 A T 1: 22,288,620 Y663* probably null Het
Rit2 T C 18: 31,153,764 T123A probably benign Het
Rmdn2 A T 17: 79,667,989 E302D probably benign Het
Ryr1 T C 7: 29,101,858 E827G possibly damaging Het
Siglec1 C T 2: 131,081,344 G494R probably damaging Het
Slc16a14 T A 1: 84,912,597 Y329F probably damaging Het
Slc35d1 A T 4: 103,214,781 L8Q possibly damaging Het
Smpdl3a C T 10: 57,801,067 S57L possibly damaging Het
Snx9 T C 17: 5,928,253 V566A probably damaging Het
Spaca1 A T 4: 34,029,095 I126N probably damaging Het
Spred1 T G 2: 117,163,571 I94S probably damaging Het
Tardbp T C 4: 148,622,037 D105G possibly damaging Het
Tet2 T C 3: 133,476,565 S1213G probably benign Het
Trak1 A T 9: 121,367,055 probably benign Het
Trem3 G A 17: 48,249,728 V76M possibly damaging Het
Ttc13 G T 8: 124,694,935 Y250* probably null Het
Ttll5 T G 12: 85,923,045 S714R possibly damaging Het
Ube2l6 T G 2: 84,802,876 probably null Het
Ubr3 T C 2: 69,973,335 S1090P probably damaging Het
Uhrf1bp1 T G 17: 27,876,990 probably null Het
Vezt T C 10: 93,970,510 T680A probably benign Het
Virma A G 4: 11,546,297 K1762E probably damaging Het
Vps53 A G 11: 76,166,248 S57P probably damaging Het
Vwa7 G T 17: 35,017,846 D130Y probably damaging Het
Vwa8 T G 14: 79,064,902 F1004V probably damaging Het
Zfp35 A T 18: 24,004,137 K513* probably null Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp521 C A 18: 13,845,448 C636F probably damaging Het
Other mutations in B3galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0101:B3galnt1 UTSW 3 69575806 missense probably benign 0.01
R0230:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R1580:B3galnt1 UTSW 3 69575707 missense possibly damaging 0.95
R1628:B3galnt1 UTSW 3 69575628 missense probably damaging 1.00
R1942:B3galnt1 UTSW 3 69575925 start codon destroyed probably null 0.90
R6418:B3galnt1 UTSW 3 69574993 missense probably damaging 1.00
R6468:B3galnt1 UTSW 3 69575533 missense probably damaging 1.00
R6473:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R7236:B3galnt1 UTSW 3 69575617 missense probably benign 0.36
R7363:B3galnt1 UTSW 3 69575824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTAAGTTCAGGCCTTGACTC -3'
(R):5'- CCAGGGTCTACGAGATGATGAG -3'

Sequencing Primer
(F):5'- TCCTGTCTAGGGAGCTCCATGAG -3'
(R):5'- CGTGAAGCCCATCAAGTTTG -3'
Posted On2016-06-21