Incidental Mutation 'R7266:Itga8'
ID564911
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Nameintegrin alpha 8
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R7266 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location12106632-12301922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12232901 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 336 (D336A)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
Predicted Effect probably damaging
Transcript: ENSMUST00000028106
AA Change: D336A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: D336A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172791
AA Change: D336A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: D336A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 24,667,623 I104F probably benign Het
Adgrg7 C T 16: 56,770,311 V166I probably benign Het
Agfg1 G T 1: 82,882,245 V278L probably benign Het
Alpk3 A G 7: 81,092,580 E715G possibly damaging Het
Ap2m1 A G 16: 20,543,345 Y401C probably damaging Het
Arhgef28 C T 13: 97,965,452 S838N probably benign Het
Ash2l A T 8: 25,827,205 Y373* probably null Het
Best2 C T 8: 85,007,764 V442I probably benign Het
Col4a2 T C 8: 11,425,542 probably null Het
Fat2 T A 11: 55,285,030 D1619V probably damaging Het
Fer1l6 A T 15: 58,627,597 N1272I probably benign Het
Gcc1 T A 6: 28,417,996 *779C probably null Het
Gm12216 G A 11: 53,859,251 probably benign Het
Gm17657 C A 17: 29,519,373 V140L probably benign Het
Gm7102 A G 19: 61,175,535 V154A possibly damaging Het
Grm2 C T 9: 106,647,171 V311I Het
Immt T A 6: 71,874,705 D683E probably benign Het
Jhy T C 9: 40,961,157 T19A probably benign Het
Kcnq2 T C 2: 181,135,092 M1V probably null Het
Kctd17 A T 15: 78,433,014 I117F probably damaging Het
Lrp6 T C 6: 134,507,401 T420A probably damaging Het
Manba T C 3: 135,517,912 S187P probably damaging Het
Mef2b A T 8: 70,164,288 D13V probably damaging Het
Mical2 T C 7: 112,303,756 F145L probably damaging Het
Mphosph8 T A 14: 56,685,040 D551E possibly damaging Het
Myo10 C G 15: 25,782,981 R1170G probably damaging Het
Myo16 A C 8: 10,272,687 Q39P unknown Het
Myo1f A G 17: 33,601,694 E837G probably benign Het
Nell2 T A 15: 95,435,393 I128F possibly damaging Het
Olfr1357 A G 10: 78,612,614 V9A probably benign Het
Pcdh15 A T 10: 74,379,390 R659* probably null Het
Pcdhga1 A G 18: 37,839,975 Q881R possibly damaging Het
Plekhm2 T G 4: 141,642,459 E75A possibly damaging Het
Prc1 A G 7: 80,307,657 K357E possibly damaging Het
Pxk T A 14: 8,146,220 C377S probably benign Het
Ralgapa2 T C 2: 146,334,568 E1696G probably damaging Het
Rbbp6 T A 7: 123,001,367 S1532R unknown Het
Scn5a G T 9: 119,562,560 A22E probably benign Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Siae T C 9: 37,623,013 V115A probably damaging Het
Slc16a6 A G 11: 109,453,281 C563R probably benign Het
Sntg1 A C 1: 8,682,019 V58G possibly damaging Het
Snx11 C T 11: 96,773,159 V36M probably damaging Het
Stk3 C A 15: 34,959,036 S330I probably benign Het
Synpo A G 18: 60,629,559 F92S probably benign Het
Tle1 A G 4: 72,139,687 probably null Het
Tmem117 A G 15: 94,931,803 D173G possibly damaging Het
Tmprss5 T C 9: 49,114,541 W338R probably benign Het
Tnfrsf19 T C 14: 60,974,698 T168A possibly damaging Het
Trhde C T 10: 114,800,871 G144S possibly damaging Het
Trim56 G T 5: 137,114,243 Q140K probably damaging Het
Ttn C T 2: 76,732,574 V28679M probably damaging Het
Ubxn8 G A 8: 33,623,203 R208C probably damaging Het
Vmn2r72 G T 7: 85,738,274 S694* probably null Het
Wdr38 T A 2: 39,000,264 W137R probably damaging Het
Zdhhc6 G T 19: 55,304,500 N271K probably damaging Het
Zfyve9 A G 4: 108,718,547 S446P possibly damaging Het
Zmynd8 T C 2: 165,807,572 Q867R possibly damaging Het
Zswim3 T C 2: 164,820,482 I294T probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12255966 nonsense probably null
IGL00820:Itga8 APN 2 12232892 missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12191714 missense probably benign
IGL01508:Itga8 APN 2 12232802 missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12160312 splice site probably benign
IGL01590:Itga8 APN 2 12160333 missense probably damaging 1.00
IGL01743:Itga8 APN 2 12265333 missense probably benign 0.04
IGL02634:Itga8 APN 2 12140478 missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12189480 missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12191199 missense probably benign 0.00
IGL03218:Itga8 APN 2 12111025 missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12132516 missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12230092 missense probably benign 0.19
R0196:Itga8 UTSW 2 12204729 critical splice donor site probably null
R0356:Itga8 UTSW 2 12182721 missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12232886 missense probably damaging 1.00
R0530:Itga8 UTSW 2 12191816 missense probably damaging 0.99
R0715:Itga8 UTSW 2 12191242 splice site probably benign
R0800:Itga8 UTSW 2 12193551 missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12262192 splice site probably null
R1675:Itga8 UTSW 2 12200163 missense probably damaging 0.99
R1758:Itga8 UTSW 2 12265333 missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12300846 missense probably damaging 1.00
R2187:Itga8 UTSW 2 12194420 missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12182709 missense probably benign 0.38
R2356:Itga8 UTSW 2 12200141 missense probably benign
R2371:Itga8 UTSW 2 12253466 missense probably damaging 1.00
R2412:Itga8 UTSW 2 12301715 missense probably benign
R2440:Itga8 UTSW 2 12178680 missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12160404 missense probably damaging 0.98
R3730:Itga8 UTSW 2 12193510 missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12189519 missense probably benign
R3982:Itga8 UTSW 2 12300963 missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4514:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4660:Itga8 UTSW 2 12265258 missense probably damaging 1.00
R4890:Itga8 UTSW 2 12193291 splice site probably benign
R5533:Itga8 UTSW 2 12160350 missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12265328 missense probably damaging 1.00
R5720:Itga8 UTSW 2 12111087 missense probably damaging 0.99
R5749:Itga8 UTSW 2 12262078 missense probably damaging 1.00
R5930:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12132486 missense probably damaging 0.99
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6211:Itga8 UTSW 2 12193509 missense probably damaging 1.00
R6337:Itga8 UTSW 2 12253469 nonsense probably null
R6442:Itga8 UTSW 2 12230143 missense probably benign 0.00
R6491:Itga8 UTSW 2 12204776 missense probably damaging 1.00
R6543:Itga8 UTSW 2 12301644 missense probably damaging 0.99
R6574:Itga8 UTSW 2 12230161 missense probably benign 0.17
R6760:Itga8 UTSW 2 12301640 missense probably damaging 1.00
R6858:Itga8 UTSW 2 12200081 missense probably benign 0.00
R6943:Itga8 UTSW 2 12155371 critical splice donor site probably null
R7048:Itga8 UTSW 2 12111084 missense probably damaging 0.99
R7203:Itga8 UTSW 2 12230095 missense possibly damaging 0.77
R7323:Itga8 UTSW 2 12262129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCATCTTGGTTCAGGTCC -3'
(R):5'- CAACTTGTCTGTGGCTTCTTAGAC -3'

Sequencing Primer
(F):5'- TTGGTTCAGGTCCCCCAAGTG -3'
(R):5'- GGCTTCTTAGACATTTCTCGCATAG -3'
Posted On2019-06-26